XLOC_015962 (ndufv2)


Basic Information

Item Value
gene id XLOC_015962
gene name ndufv2
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 54641644 ~ 54690184 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00031633
ATCCTGGCATGTCAAGAACACAATGTGCGTCTGTGTTATTTTTATCTTTCGCTCGGTGTTCTATTATACAGACTCATAGTTCACAGCCAGCATACGTAACCAGACCCGCTCAATCGAACTCGCGATCTGGTGTCCGCCGTTGCTTGTGTTTAGTGTGACCGAGCGCGTTAAAAAAGATGTTTTTATCCTCAACCCTGCGCTCTGCCGTCTCATATACGGCGAGGCAGGTGCGGAGTCTGCATCAGACATCAGCTCGAGCAGGAGCAGGAGGAATCTTTGTGCACAGAGACACACCAGAAAACAATCCGGACACCCCATTTGAGTTCACCCCTGAAAACATGAAGCGAGTTGAGGCCATCATTAATAATTACCCAGAGGGACACAAGGCGGCCGCTACTATTCCTGTGCTGGATTTGGCTCAGAGGCAGAATGGATGGCTTCCTATTTCTGCCATGAACAAGGTGGCAGAGGTCCTGGGCATTGCTCCTATGAGGGTTTATGAAGTAGCGACTTTCTACACAATGTTCCTCCGTCAGCCGGTGGGCAAATACCACATCCAGATCTGCACCACCACACCGTGCATGTTGTGTGACTCCGACAGCATCCTGGAAGCCATCCAGAACAAATTGGGTATTAAAGTCGGGGAGACCACAGCAGATAAGTTATTCACGCTGACAGAAGTGGAGTGTCTCGGAGCTTGTGTGAACGCACCGATGGTCCAAATCAACGATAACTATTATGAGGATCTTAAACCATCAGACATGGAGCAGATTATTGATGAGCTGAAGGCAGGCAGAGTTCCTCCTCCTGGACCCAGGAGCGGCCGTTTCTCGTGTGAGCCGGCGGGAGGATTAACCTCGCTGACTGAACCTCCTCCTGGACCCGGTGTTGGTGTGAGAGCTGACCTGTAA

Function

symbol description
ndufv2 Predicted to enable 2 iron, 2 sulfur cluster binding activity; metal ion binding activity; and oxidoreductase activity. Predicted to be involved in mitochondrial electron transport, NADH to ubiquinone. Predicted to be part of mitochondrial respiratory chain complex I. Is expressed in several structures, including alar plate midbrain region; digestive system; optic tectum; optic vesicle; and retina. Human ortholog(s) of this gene implicated in Parkinson's disease and nuclear type mitochondrial complex I deficiency 7. Orthologous to human NDUFV2 (NADH:ubiquinone oxidoreductase core subunit V2).

GO:

id name namespace
GO:0006120 mitochondrial electron transport, NADH to ubiquinone biological_process
GO:0022904 respiratory electron transport chain biological_process
GO:0055114 oxidation-reduction process biological_process
GO:0005747 mitochondrial respiratory chain complex I cellular_component
GO:0046872 metal ion binding molecular_function
GO:0016491 oxidoreductase activity molecular_function
GO:0051536 iron-sulfur cluster binding molecular_function
GO:0051537 2 iron, 2 sulfur cluster binding molecular_function

KEGG:

id description
ko00190 Oxidative phosphorylation
ko04723 Retrograde endocannabinoid signaling
ko04714 Thermogenesis
ko05208 Chemical carcinogenesis - reactive oxygen species
ko05010 Alzheimer disease
ko05012 Parkinson disease
ko05014 Amyotrophic lateral sclerosis
ko05016 Huntington disease
ko05020 Prion disease
ko05022 Pathways of neurodegeneration - multiple diseases
ko05415 Diabetic cardiomyopathy
ko04932 Non-alcoholic fatty liver disease

ZFIN:

id description
ZDB-GENE-040426-1713 Predicted to enable 2 iron, 2 sulfur cluster binding activity; metal ion binding activity; and oxidoreductase activity. Predicted to be involved in mitochondrial electron transport, NADH to ubiquinone. Predicted to be part of mitochondrial respiratory chain complex I. Is expressed in several structures, including alar plate midbrain region; digestive system; optic tectum; optic vesicle; and retina. Human ortholog(s) of this gene implicated in Parkinson's disease and nuclear type mitochondrial complex I deficiency 7. Orthologous to human NDUFV2 (NADH:ubiquinone oxidoreductase core subunit V2).

Ensembl:

ensembl_id ENSDARG00000013044

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00031633 True 911 mRNA 0.51 8 54641644 54690184

Neighbor

gene id symbol gene type direction distance location
XLOC_015961 mtcl1 coding upstream 132579 54482603 ~ 54509065 (+)
XLOC_015960 CABZ01050280.1 coding upstream 193931 54430632 ~ 54447713 (+)
XLOC_015959 NA coding upstream 213706 54425088 ~ 54427938 (+)
XLOC_015958 rab12 coding upstream 218008 54387710 ~ 54423636 (+)
XLOC_015957 LO018508.1 coding upstream 288019 54327160 ~ 54353625 (+)
XLOC_015963 ankrd12 coding downstream 5858 54696042 ~ 54786748 (+)
XLOC_015964 twsg1a coding downstream 108505 54798689 ~ 54834764 (+)
XLOC_015965 rnf126 coding downstream 154571 54844755 ~ 54980150 (+)
XLOC_015966 zmp:0000000521 coding downstream 509537 55199721 ~ 55225028 (+)
XLOC_015967 cib3 coding downstream 559654 55249838 ~ 55266971 (+)
XLOC_015956 CU179656.2 non-coding upstream 327435 54305610 ~ 54314209 (+)
XLOC_015955 NA non-coding upstream 371278 54085893 ~ 54270366 (+)
XLOC_015954 NA non-coding upstream 597853 54042778 ~ 54043791 (+)
XLOC_015968 NA non-coding downstream 577836 55268020 ~ 55269290 (+)
XLOC_015971 NA non-coding downstream 912944 55603128 ~ 55603565 (+)
XLOC_015973 NA non-coding downstream 1087638 55777822 ~ 55780037 (+)
XLOC_015974 NA non-coding downstream 1092353 55782537 ~ 55784445 (+)
XLOC_015978 NA non-coding downstream 1434819 56125003 ~ 56130443 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000075_00537393_00544463 NDUFV2 coding CI01000075 null 537334 ~ 544463 (-)