AMCG00018234 (LOC106579194,LOC106578326,LOC105031632,LOC103369159)


Basic Information

Item Value
gene id AMCG00018234
gene name LOC106579194,LOC106578326,LOC105031632,LOC103369159
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030135.1
NCBI id CM030135.1
chromosome length 28454832
location 5022592 ~ 5023227 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00018234
ATGGGGTTTTCACAGGCTCTTCTCCTCTACGTGTTGATGTCCATCCATGTAGGCGCCTCGAATCATTTCCTCCGGCTCCGACCTTCGCCCAGCGACACCCTGCCGGTGCCCGACCTCATCGAGCACCCGGACCCGGAGTACGACCCCCGGGAGCAGGACCTGGCCGAGAGGACCCTGAGGAAGAAGCTCGGCAGCCACTTCGACCCCAACTTCATGTCCATCAGCTCCCCCGTGCTGGTGAACCTGTCCGCGCAAGACGAGCAGCTGCGGCTGCCGGGACCCATGCCCAACGACCTCAAGAAGCTGGACCTTTCGGAAACCCCCTACGGGAGGCGGGTGAAGATGGGCAAGAAGGCGCGCAGGAAATTTCTGCAGTGGTTGTGGACCTATACCCACTGCCCCGTGGTGCACACATGGAAGGACCTGGGCGTGAGGTTCTGGCCGCGCTACATCAAGGAGGGCAACTGTTTCAATGGGCGCTCCTGTTCCTTCCCAGAGGGGATGTTCTGCAAACCCGCAAAGTCCATCACCAAGACTTTCCTCAGGTGGTACTGCCAAGGTTTCTCAAGACAGAAATACTGCACATGGCTACCCGTGCAGTACCCCATCATCTCAGAGTGCAAGTGTTCTTGCTGA

Function

NR:

description
PREDICTED: noggin-2-like

GO:

id name namespace
GO:0045596 negative regulation of cell differentiation biological_process

KEGG:

id description
K04658 NOG; noggin

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00018234 True 636 mRNA 0.59 1 5022592 5023227

Neighbor

gene id symbol gene type direction distance location
AMCG00018235 NA coding upstream 28424 4972950 ~ 4994168 (+)
AMCG00018233 NA coding upstream 138739 4874927 ~ 4883853 (+)
AMCG00018231 amdhd2,LOC107661858 coding upstream 202998 4816830 ~ 4819594 (+)
AMCG00018224 NA coding upstream 274425 4747310 ~ 4748167 (+)
AMCG00018225 NA coding upstream 284700 4732148 ~ 4737892 (+)
AMCG00018237 LOC102777150,LOC102206336,LOC101478571,LOC100698643,LOC101065496 coding downstream 35151 5058378 ~ 5059421 (+)
AMCG00018238 LOC101065496,LOC101160359,LOC106579193,LOC107556665 coding downstream 52892 5076119 ~ 5094692 (+)
AMCG00018236 NA coding downstream 148275 5171502 ~ 5183063 (+)
AMCG00018242 atp6v0c,LOC107552490,LOC106516477,LOC106517404,LOC107376678 coding downstream 169990 5193217 ~ 5204864 (+)
AMCG00018243 spsb3,LOC101158278,LOC106600674 coding downstream 189908 5213135 ~ 5222485 (+)
G115061 NA non-coding upstream 208173 4814018 ~ 4814419 (+)
G114985 NA non-coding upstream 428747 4593460 ~ 4593845 (+)
G114984 NA non-coding upstream 432518 4589295 ~ 4590074 (+)
G114940 NA non-coding upstream 635703 4386180 ~ 4386889 (+)
G114888 NA non-coding upstream 720914 4298638 ~ 4301678 (+)
G115099 NA non-coding downstream 71921 5095148 ~ 5100938 (+)
G115188 NA non-coding downstream 293226 5316453 ~ 5317925 (+)
G115201 NA non-coding downstream 321260 5344487 ~ 5344947 (+)
G115331 LOC100136012 non-coding downstream 1022803 6046030 ~ 6046534 (+)
G115379 c2h16orf72,LOC105900007,LOC107685917,LOC107590581 non-coding downstream 1502492 6525719 ~ 6588409 (+)
G115049 NA other upstream 258687 4761518 ~ 4763905 (+)
AMCG00018216 telo2 other upstream 418487 4594933 ~ 4604105 (+)
AMCG00018196 NA other upstream 829262 4186410 ~ 4193330 (+)
G114551 NA other upstream 2374818 2640846 ~ 2647774 (+)
G114518 NA other upstream 2453654 2491313 ~ 2568938 (+)
G115299 NA other downstream 926236 5949463 ~ 5951017 (+)
AMCG00018272 NA other downstream 1132261 6155488 ~ 6160616 (+)
AMCG00018280 NA other downstream 1687255 6710482 ~ 6747438 (+)
G115590 fbxl16,LOC107685932,LOC107568165,LOC107738613,LOC107568127,LOC107690242 other downstream 2870400 7893627 ~ 7894449 (+)
G115648 NA other downstream 3096551 8119778 ~ 8122171 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) G472798 NA non-coding CI01000329 null 941102 ~ 943061 (+)
eurasian perch (Perca fluviatilis) G213483 LOC103369159,LOC102777434,LOC101160110 non-coding NC_053132.1 CM020929.1 17518193 ~ 17520849 (-)