G19970


Basic Information

Item Value
gene id G19970
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 13201432 ~ 13201633 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU22430
AAAGTGACTCATATTAATTTTAAGTAATTCTCCACTATTCTAGTGCATAAGTTTGCTACTTAAGACTTTAAAACTTCATAAAAATAATACATTTAAAGCACAATTAAGAACAGAAACACTAATTTGCCTCAGCACCCTATTATGATGTAACTCTCTCTTTACCACTCTGAAAAACACCTGGCAATGTCTTGATGGCCTTCTA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU22430 True 202 lncRNA 0.34 1 13201432 13201633

Neighbor

gene id symbol gene type direction distance location
CI01000001_13160253_13167224 MYB coding upstream 32927 13160253 ~ 13168505 (+)
CI01000001_13011184_13014251 TBPL1 coding upstream 187170 13009419 ~ 13014262 (+)
CI01000001_13002416_13005974 NA coding upstream 195399 13002214 ~ 13006033 (+)
CI01000001_12991367_12993048 NA coding upstream 207989 12991276 ~ 12993443 (+)
CI01000001_12926362_12928572 RPS12, RGD1561102, RPS12-PS2, RPS12P4, GM4925, RPS12.S coding upstream 272853 12925414 ~ 12928579 (+)
CI01000001_13220895_13223877 ARMC1L coding downstream 19262 13220895 ~ 13224370 (+)
CI01000001_13235608_13240350 NA coding downstream 33975 13235608 ~ 13240441 (+)
CI01000001_13242387_13245977 NEMP1 coding downstream 40754 13242387 ~ 13246245 (+)
CI01000001_13266612_13285039 PAN2 coding downstream 64910 13266543 ~ 13285293 (+)
CI01000001_13290327_13291466 PLAGX coding downstream 87974 13289607 ~ 13293479 (+)
G19969 NA non-coding upstream 127 13201102 ~ 13201305 (+)
G19968 NA non-coding upstream 637 13200579 ~ 13200795 (+)
G19967 NA non-coding upstream 1197 13199999 ~ 13200235 (+)
G19965 NA non-coding upstream 2376 13198680 ~ 13199056 (+)
G19964 NA non-coding upstream 2766 13198376 ~ 13198666 (+)
G19972 NA non-coding downstream 1917 13203550 ~ 13203772 (+)
G19979 NA non-coding downstream 6992 13208625 ~ 13208973 (+)
G19880 NA non-coding downstream 39207 13240840 ~ 13241241 (+)
G19864 NA non-coding downstream 39837 13241470 ~ 13242127 (+)
G19990 NA non-coding downstream 94343 13295976 ~ 13296334 (+)
G19395 NA other upstream 1519615 11681322 ~ 11681817 (+)
G19314 NA other upstream 1642759 11501194 ~ 11558673 (+)
G19039 NA other upstream 2347449 10850924 ~ 10853983 (+)
CI01000001_10538498_10539667 RPS26 other upstream 2661586 10538388 ~ 10539846 (+)
G18937 NA other upstream 2725043 10474984 ~ 10476389 (+)
CI01000001_13514115_13517063 NA other downstream 311771 13514115 ~ 13517063 (+)

Expression


Co-expression Network