G28647


Basic Information

Item Value
gene id G28647
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 7297092 ~ 7297341 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU32389
CTTTTGAACTGAACGCTGATAACACGCTGGAAGGTCTCCCTCCTCTTTAGCCCGGAGGACACGGCGTCCGTGATTTCCAACAAGAATGTCAAATTTGGACTCGTCTGACCATAGAACACTTTTCCACTTTGAAACAGTCCATTTTAAATGAGCCTTGGCCCACAAGACACGACGGCACTTCTGGAATATGTTCACATATGGCTTCCTTTTTGCATGATAGAGCTTTAGTTGGCATCTGCAGATGGCACGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU32389 True 250 lncRNA 0.49 1 7297092 7297341

Neighbor

gene id symbol gene type direction distance location
CI01000004_07262498_07264843 RPP40 coding upstream 31499 7262273 ~ 7265593 (+)
CI01000004_07254370_07254880 LYRM4 coding upstream 41843 7254370 ~ 7255602 (+)
CI01000004_07249855_07250697 NRN1B coding upstream 45659 7249591 ~ 7251433 (+)
CI01000004_07196152_07199384 NEBL coding upstream 97678 7196152 ~ 7199414 (+)
CI01000004_07164273_07167923 BMI1B, BMI1 coding upstream 128856 7164273 ~ 7168236 (+)
CI01000004_07306344_07318193 OXSR1B, OXSR1, OXSR1A coding downstream 8916 7306257 ~ 7318449 (+)
CI01000004_07319769_07320274 NA coding downstream 21815 7319156 ~ 7320711 (+)
CI01000004_07322380_07326368 NA coding downstream 24925 7322266 ~ 7326548 (+)
CI01000004_07360794_07364249 CSRNP1A coding downstream 62431 7359772 ~ 7364599 (+)
CI01000004_07366683_07372144 GORASP1, GORASP1A coding downstream 69342 7366683 ~ 7372438 (+)
G28406 NA non-coding upstream 1694 7289641 ~ 7295398 (+)
G28634 NA non-coding upstream 48315 7248548 ~ 7248777 (+)
G28606 NA non-coding upstream 101440 7195049 ~ 7195652 (+)
G28405 NA non-coding upstream 146605 7149337 ~ 7150487 (+)
G28651 NA non-coding downstream 4384 7301725 ~ 7301988 (+)
G28657 NA non-coding downstream 54664 7352005 ~ 7352230 (+)
G28432 NA non-coding downstream 82725 7380066 ~ 7380596 (+)
G28423 NA non-coding downstream 83415 7380756 ~ 7382325 (+)
G28372 NA non-coding downstream 87703 7385044 ~ 7387399 (+)
CI01000004_06571261_06572539 SEP15 other upstream 722671 6570771 ~ 6572667 (+)
G28302 NA other upstream 795005 6470028 ~ 6502087 (+)
G28165 NA other upstream 1564091 5732589 ~ 5733001 (+)
G27805 NA other upstream 1923289 5372825 ~ 5373803 (+)
CI01000004_03550525_03552621 PTGER4C other upstream 3744646 3550329 ~ 3553423 (+)
CI01000004_07654234_07655677 MRPL34 other downstream 357431 7654234 ~ 7656383 (+)
CI01000004_08414451_08436256 NA other downstream 1136364 8414316 ~ 8439933 (+)
G28859 NA other downstream 1301894 8599235 ~ 8599603 (+)
CI01000004_08976512_08980033 TTPA other downstream 1679097 8976254 ~ 8980984 (+)
G30797 NA other downstream 3200035 10497376 ~ 10497788 (+)

Expression


Co-expression Network