G31140


Basic Information

Item Value
gene id G31140
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000004
NCBI id null
chromosome length 17451736
location 10541949 ~ 10542189 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU35245
CCTGAGCACTAATGGATTCTTTCCGGGTGGTGTAGATAACCTCTCCTGACCGTCCAGTGGTGAGTCCAGTTCCAGAGGGGTAGAATCTGCGTGGAGGGGGAGGGGGAGGTGATTTACTGGTCATCTCAGGGTTGGGCTTCACTCTGTCAACACTGGCCCTGTGGGGTTTTCCTATGGTCGGCTTCTGTGGCCTTTCCAAACTGGTCTGGACTGGTTTATCGACTATGGGTCCATCCTGTGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU35245 True 241 lncRNA 0.55 1 10541949 10542189

Neighbor

gene id symbol gene type direction distance location
CI01000004_10458668_10465442 NA coding downstream 76246 10458662 ~ 10465703 (-)
CI01000004_10436514_10438365 NA coding downstream 102490 10436499 ~ 10439459 (-)
CI01000004_10290550_10295288 CAHZ coding downstream 246592 10289863 ~ 10295357 (-)
CI01000004_10271350_10272027 NA coding downstream 269743 10271198 ~ 10272206 (-)
CI01000004_09779903_09780536 NA coding downstream 761071 9779235 ~ 9780878 (-)
CI01000004_10553379_10573352 PAXIP1 coding upstream 10848 10553037 ~ 10575243 (-)
CI01000004_10619819_10627261 CNPY1 coding upstream 76830 10619019 ~ 10627261 (-)
CI01000004_10692864_10704094 TRPA1A coding upstream 150448 10692637 ~ 10704094 (-)
CI01000004_10757852_10760211 NA coding upstream 215354 10757543 ~ 10761142 (-)
CI01000004_10766385_10766860 TCEB1B, TCEB1, GM14517, TCEB1A coding upstream 224151 10766340 ~ 10766860 (-)
G31105 NA non-coding downstream 60827 10480817 ~ 10481122 (-)
G31089 NA non-coding downstream 83346 10456380 ~ 10458603 (-)
G31077 NA non-coding downstream 106413 10434154 ~ 10435536 (-)
G31060 NA non-coding downstream 115604 10393326 ~ 10426345 (-)
G31070 NA non-coding downstream 131032 10410129 ~ 10410917 (-)
G31135 NA non-coding upstream 2445 10544634 ~ 10550641 (-)
G31139 NA non-coding upstream 68094 10610283 ~ 10611074 (-)
G31142 NA non-coding upstream 69630 10611819 ~ 10613648 (-)
G31172 NA non-coding upstream 87755 10629944 ~ 10631721 (-)
G31173 NA non-coding upstream 93981 10636170 ~ 10636383 (-)
G30316 NA other downstream 1135028 9377937 ~ 9406921 (-)
G29746 NA other downstream 2183822 8354498 ~ 8358127 (-)
G29656 NA other downstream 2576449 7964364 ~ 7965500 (-)
G29388 NA other downstream 3910042 6631293 ~ 6631907 (-)
CI01000004_06539836_06541252 NA other downstream 3996377 6538904 ~ 6541252 (-)
G31203 NA other upstream 204248 10746437 ~ 10750641 (-)
CI01000004_11407198_11412220 ADCYAP1B, ADCYAP1 other upstream 865276 11406957 ~ 11412907 (-)
G32150 NA other upstream 1234330 11776519 ~ 11780951 (-)
G32207 NA other upstream 1833979 12376168 ~ 12384780 (-)
CI01000004_14543631_14551256 NA other upstream 4008611 14541515 ~ 14551352 (-)

Expression


Co-expression Network