G141515


Basic Information

Item Value
gene id G141515
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 4364046 ~ 4381587 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU160804
GTTGTAGTGGGCTGGATTAAGAAGATGCTCCACCAGTCTCTCTTCTGTATCTGCCCCATCACTGCTTTTCACAATGGCGAGGATGCAGAAGAGCGTCCACAGAGCCATCATCTCAGCGAGGACTGGGAAGCATCTGCCGCGCGTGAACTGCTCTCTCCCGTGGGCGCGTGTGGTCGTGCGTATCGGAGCGTGACTTTGTCGAGGTGGACGCGCGCAATGGTTAAACTATATTTTCTTTCTTCTCGACGTTATTCGGTACCTGGCATCGTTACGTTAGCGGTTCTGGGTTACTGAACGCGTAGTTCCACCCCGCGAGCGTGAGGGAATGGTTTTATGAGCAGCCAGGTAGATGAAGGACTAATCGCGGTGCGCGAGAGAAGATGCGACGAGATGACAGAAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU160804 True 401 lncRNA 0.54 2 4364046 4381587

Neighbor

gene id symbol gene type direction distance location
CI01000027_04324807_04339354 NA coding downstream 24692 4324676 ~ 4339354 (-)
CI01000027_04254645_04264857 NA coding downstream 99189 4254167 ~ 4264857 (-)
CI01000027_04233680_04249553 SCAP coding downstream 114493 4233642 ~ 4249553 (-)
CI01000027_04206424_04209369 NA coding downstream 154666 4205610 ~ 4209445 (-)
CI01000027_04156256_04198063 NEK11 coding downstream 165983 4156256 ~ 4198063 (-)
CI01000027_04401843_04403095 S100A11, S100T, S100S coding upstream 19903 4401490 ~ 4403095 (-)
CI01000027_04419264_04422151 NA coding upstream 36520 4418107 ~ 4422380 (-)
CI01000027_04424958_04434987 NA coding upstream 42722 4424309 ~ 4435229 (-)
CI01000027_04439446_04461699 SHC1 coding upstream 56053 4437640 ~ 4462204 (-)
CI01000027_04464282_04466128 NA coding upstream 82148 4463735 ~ 4466257 (-)
G141513 NA non-coding downstream 811 4362849 ~ 4363235 (-)
G141475 NA non-coding downstream 73565 4290274 ~ 4290481 (-)
G141471 NA non-coding downstream 81911 4281909 ~ 4282135 (-)
G141470 NA non-coding downstream 82217 4281505 ~ 4281829 (-)
G141461 NA non-coding downstream 99324 4263902 ~ 4264722 (-)
G141519 NA non-coding upstream 11816 4393403 ~ 4396404 (-)
G141539 NA non-coding upstream 128672 4510259 ~ 4510623 (-)
CI01000027_04603997_04606475 NA non-coding upstream 188337 4603444 ~ 4608289 (-)
G141572 NA non-coding upstream 235419 4617006 ~ 4619841 (-)
G141490 NA non-coding upstream 248749 4630336 ~ 4637669 (-)
CI01000027_03922380_03931033 NA other downstream 438474 3922242 ~ 3931033 (-)
CI01000027_03787377_03788902 NA other downstream 574824 3787377 ~ 3790279 (-)
G140118 NA other downstream 779367 3509352 ~ 3584679 (-)
CI01000027_02226447_02227499 NA other downstream 2136021 2225781 ~ 2227499 (-)
CI01000027_02119227_02124423 NA other downstream 2238018 2119131 ~ 2125142 (-)
G141488 NA other upstream 125888 4507475 ~ 4508971 (-)
G141728 NA other upstream 495480 4877067 ~ 4877766 (-)
G141588 NA other upstream 726748 5108335 ~ 5201155 (-)
CI01000027_05447458_05450346 PON2, PON3.2, PON3.1 other upstream 1067739 5447424 ~ 5450461 (-)
G141638 NA other upstream 2407040 6788627 ~ 6796707 (-)

Expression


Co-expression Network