CI01000027_04401843_04403095 (S100A11, S100T, S100S)


Basic Information

Item Value
gene id CI01000027_04401843_04403095
gene name S100A11, S100T, S100S
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 4401490 ~ 4403095 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000027_04401843_04403095.mRNA
CATTCATCTCTCCTCAAGGAACAGAAGAACAGCAACCATCTAACAGCAAGAATGTCCGCTTTTAACTCAGAGAATGCCTCCACTCTGGAGAACGCCATGCAGCTGATGATTCAGACGTTCCACAAGTACTCTGGGAATGAGGGCGACAAATATACTCTCAGTAGGCAGGAACTCAAAGAGATGCTAACGCAGGAGCTGGGCAACTACCTTGGGAATGCACAGGATAAGGATGCGGTAGATAAAGTTATGGGAGACCTGGATTCAAACAACGACGGTGAGGTGGACTTCACAGAGTTCATCATCCTTGTGGGCGCCCTCACCGTCGCCTGCAACGACTTCTTCCTTGAGTATCACGAAAAGGACGGAAAGAAGAAAGAGTAGAGCTGAATTTCTCTGAACAAAAGCCAACACATGACCAGTGAAGGATGATTAGAGGGAAATGGGGGGAGAAGGGAAATATTTGTGTGTATGAATCTTGCTTACTGATACCGAAAATGTTTTACCTCTTCATCCACGTTCAGTGCAATCCTGGGTACACAAAATGCTCCATGAGGAGCAACATGTTTCCAACCCCTGAAACAACCTATTAGAAATGAAAGCATAAGGAATGAGATTGTGAGATGGTCTTTGTTGAATATGTGAATATGTGTTTCTTCCTTTGTTTTGTTTTTTAACAATTGGAGTTGTTCATTTTAAAATAATCTCTCCATATTAAACTGCAAATTTAAAATAAA

Function

symbol description
s100a11 Predicted to enable calcium ion binding activity and calcium-dependent protein binding activity. Predicted to be active in extracellular space and perinuclear region of cytoplasm. Is expressed in gill; hematopoietic system; integument; olfactory epithelium; and pericardium. Orthologous to human S100A11 (S100 calcium binding protein A11) and S100A13 (S100 calcium binding protein A13).
s100s Predicted to enable calcium ion binding activity and calcium-dependent protein binding activity. Predicted to be active in cytoplasm. Is expressed in several structures, including digestive system; heart; integument; otic vesicle; and sensory system. Orthologous to several human genes including S100A2 (S100 calcium binding protein A2); S100A4 (S100 calcium binding protein A4); and S100A5 (S100 calcium binding protein A5).
s100t Predicted to enable calcium ion binding activity and calcium-dependent protein binding activity. Predicted to be active in cytoplasm. Is expressed in several structures, including digestive system; heart; hematopoietic system; integument; and sensory system.

NR:

description
unnamed protein product, partial

GO:

id name namespace
GO:0005575 cellular_component cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000027_04401843_04403095.mRNA True 734 mRNA 0.42 3 4401490 4403095

Neighbor

gene id symbol gene type direction distance location
CI01000027_04324807_04339354 NA coding downstream 62136 4324676 ~ 4339354 (-)
CI01000027_04254645_04264857 NA coding downstream 136633 4254167 ~ 4264857 (-)
CI01000027_04233680_04249553 SCAP coding downstream 151937 4233642 ~ 4249553 (-)
CI01000027_04206424_04209369 NA coding downstream 192110 4205610 ~ 4209445 (-)
CI01000027_04156256_04198063 NEK11 coding downstream 203427 4156256 ~ 4198063 (-)
CI01000027_04419264_04422151 NA coding upstream 15012 4418107 ~ 4422380 (-)
CI01000027_04424958_04434987 NA coding upstream 21214 4424309 ~ 4435229 (-)
CI01000027_04439446_04461699 SHC1 coding upstream 34545 4437640 ~ 4462204 (-)
CI01000027_04464282_04466128 NA coding upstream 60640 4463735 ~ 4466257 (-)
CI01000027_04524446_04527464 NA coding upstream 120716 4523811 ~ 4527464 (-)
G141519 NA non-coding downstream 5086 4393403 ~ 4396404 (-)
G141515 NA non-coding downstream 19903 4364046 ~ 4381587 (-)
G141513 NA non-coding downstream 38255 4362849 ~ 4363235 (-)
G141475 NA non-coding downstream 111009 4290274 ~ 4290481 (-)
G141471 NA non-coding downstream 119355 4281909 ~ 4282135 (-)
G141539 NA non-coding upstream 107164 4510259 ~ 4510623 (-)
CI01000027_04603997_04606475 NA non-coding upstream 166829 4603444 ~ 4608289 (-)
G141572 NA non-coding upstream 213911 4617006 ~ 4619841 (-)
G141490 NA non-coding upstream 227241 4630336 ~ 4637669 (-)
G141679 NA non-coding upstream 305693 4708788 ~ 4708995 (-)
CI01000027_03922380_03931033 NA other downstream 475918 3922242 ~ 3931033 (-)
CI01000027_03787377_03788902 NA other downstream 612268 3787377 ~ 3790279 (-)
G140118 NA other downstream 816811 3509352 ~ 3584679 (-)
CI01000027_02226447_02227499 NA other downstream 2173465 2225781 ~ 2227499 (-)
CI01000027_02119227_02124423 NA other downstream 2275462 2119131 ~ 2125142 (-)
G141488 NA other upstream 104380 4507475 ~ 4508971 (-)
G141728 NA other upstream 473972 4877067 ~ 4877766 (-)
G141588 NA other upstream 705240 5108335 ~ 5201155 (-)
CI01000027_05447458_05450346 PON2, PON3.2, PON3.1 other upstream 1046231 5447424 ~ 5450461 (-)
G141638 NA other upstream 2385532 6788627 ~ 6796707 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location