G144285


Basic Information

Item Value
gene id G144285
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000027
NCBI id null
chromosome length 10680226
location 10525072 ~ 10525360 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU163911
TTGCCTCTCATTCTCTTTTATGATGTCAGCTTCTTGTTTAAGACAAGCTGGACGTCAGAGTAATGTGGGTCTTAAAAGGGAAAATTAAATCTGAAAATAATTTATGCATTGTTTTTGTTTCTTGCTTGGTCGACCCCTATTTGCAGTGCATTGCTGTTGTTGTCACATTTGATTTTAACTGAAAGCGAACAACTGAAGAAAAACATGACAAAAGAACATTACAGAGTCTGAACTGTTTCTACAATATTAGTGCAAATCTCTGCGTAAGTTCTCTCAACTCTCAAAAGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU163911 True 289 lncRNA 0.36 1 10525072 10525360

Neighbor

gene id symbol gene type direction distance location
CI01000027_10437783_10448105 FHL3, FHL3A, FHL3.S coding upstream 76717 10437783 ~ 10448355 (+)
CI01000027_10408345_10410012 NA coding upstream 114710 10406096 ~ 10410362 (+)
CI01000027_10368925_10370031 POU3F1, POU3F1.L, POU3F1.S coding upstream 153767 10368407 ~ 10371305 (+)
CI01000027_10098742_10105152 RRAGC.S, RRAGCA, RRAGCB, RRAGC coding upstream 419764 10098712 ~ 10105308 (+)
CI01000027_10090545_10093306 CX55.5 coding upstream 431326 10090545 ~ 10093746 (+)
CI01000027_10526694_10541815 GNL2 coding downstream 1334 10526694 ~ 10542130 (+)
CI01000027_10545286_10547348 NA coding downstream 19926 10545286 ~ 10547894 (+)
CI01000027_10548922_10551337 GPN2 coding downstream 23562 10548922 ~ 10551652 (+)
CI01000027_10574326_10578596 NA coding downstream 48966 10574326 ~ 10579827 (+)
CI01000027_10580514_10590458 ZDHHC18A coding downstream 54831 10580191 ~ 10590903 (+)
G144275 NA non-coding upstream 22829 10502015 ~ 10502243 (+)
G144266 NA non-coding upstream 37271 10487373 ~ 10487801 (+)
G144265 NA non-coding upstream 37731 10487140 ~ 10487341 (+)
G144251 NA non-coding upstream 65506 10459325 ~ 10459566 (+)
G144063 NA non-coding upstream 121713 10402682 ~ 10403359 (+)
G144300 NA non-coding downstream 29604 10554964 ~ 10555279 (+)
G144305 NA non-coding downstream 72694 10598054 ~ 10598262 (+)
G144296 NA non-coding downstream 95848 10621208 ~ 10636932 (+)
G144298 NA non-coding downstream 114864 10640224 ~ 10640459 (+)
CI01000027_10662823_10669634 OPRD1B, OPRD1 non-coding downstream 136311 10661410 ~ 10669742 (+)
G143033 NA other upstream 795521 9728815 ~ 9729551 (+)
CI01000027_08255251_08264629 NA other upstream 2264246 8255073 ~ 8264897 (+)
CI01000027_08026500_08029412 ENSAB, ENSA other upstream 2493031 8025788 ~ 8032041 (+)
CI01000027_07947743_07951397 NA other upstream 2573130 7947657 ~ 7951942 (+)
CI01000027_07469157_07471720 NA other upstream 3053358 7468964 ~ 7471999 (+)

Expression


Co-expression Network