G163543


Basic Information

Item Value
gene id G163543
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 8374785 ~ 8375063 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU185800
TGAATCTCAACAGCGGTGACTGTCAAAAAGCATGTTGCAATGCATTCTGGGAGCCACCAATCAAAATTCATCCACGGCTCCCATCATGCATTGCTGCATGAATAAATTATGAGCTTAATTGTCTTAGTAATTTTCTTTATTCTAACTATTTTATTTTTTGCTGTTTTTATGTGACTTTTTAGTAGCTTGTTTTCTAATGTTCAGAGTTGATCTGTTTATCAGAATATGTTGCTTGTCACCGTTGTTGAGATTCACAGGCTGATTCTTGATGTCTGTGTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU185800 True 279 lncRNA 0.36 1 8374785 8375063

Neighbor

gene id symbol gene type direction distance location
CI01000030_08350086_08366927 NA coding downstream 7706 8349698 ~ 8367079 (-)
CI01000030_08335819_08343892 NA coding downstream 28887 8335563 ~ 8345898 (-)
CI01000030_08328834_08331465 NA coding downstream 43245 8328102 ~ 8331540 (-)
CI01000030_08232550_08241049 NA coding downstream 133736 8232101 ~ 8241049 (-)
CI01000030_08201019_08203601 NA coding downstream 171140 8200166 ~ 8203645 (-)
CI01000030_08393024_08396689 NA coding upstream 16926 8391989 ~ 8396748 (-)
CI01000030_08399321_08402641 NA coding upstream 24100 8399163 ~ 8402924 (-)
CI01000030_08440613_08441821 NA coding upstream 65481 8440544 ~ 8441836 (-)
CI01000030_08450632_08457703 NA coding upstream 75113 8450176 ~ 8457975 (-)
CI01000030_08467514_08479103 NA coding upstream 92410 8467473 ~ 8479252 (-)
G163541 NA non-coding downstream 15049 8359522 ~ 8359736 (-)
G163540 NA non-coding downstream 17659 8356894 ~ 8357126 (-)
G163528 NA non-coding downstream 63653 8310901 ~ 8311132 (-)
G163520 NA non-coding downstream 90303 8284251 ~ 8284482 (-)
G163544 NA non-coding upstream 29937 8405000 ~ 8405234 (-)
G163549 NA non-coding upstream 49567 8424630 ~ 8424891 (-)
G163409 NA non-coding upstream 54889 8429952 ~ 8432173 (-)
G163403 NA non-coding upstream 88714 8463777 ~ 8466289 (-)
G163552 NA non-coding upstream 108342 8483405 ~ 8513971 (-)
CI01000030_08185866_08194632 NA other downstream 182299 8184897 ~ 8197266 (-)
CI01000030_07788973_07791700 TUSC2B, TUSC2 other downstream 582403 7788797 ~ 7792198 (-)
CI01000030_07736031_07737720 LSM7.L, GM13182, LSM7 other downstream 636781 7735436 ~ 7737720 (-)
G163139 NA other downstream 1224641 7149474 ~ 7150144 (-)
G163065 NA other downstream 1449128 6924483 ~ 6925657 (-)
G163873 NA other upstream 558350 8933413 ~ 8933982 (-)
CI01000030_09277337_09294501 NA other upstream 912143 9276431 ~ 9294802 (-)
G164071 NA other upstream 1100125 9475188 ~ 9476264 (-)
CI01000030_10103451_10131419 NA other upstream 1740452 10102944 ~ 10133765 (-)

Expression


Co-expression Network