CI01000032_01634351_01638604 (GLOD5)



Basic Information


Item Value
gene id CI01000032_01634351_01638604
gene name GLOD5
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000032
NCBI id null
chromosome length 4185905
location 1634351 ~ 1638669 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>CI01000032_01634351_01638604.mRNA
GTTAGAACAGGTGATATCGTGAGTGACATTAGACTTTTCACTGTTAAAATGGCTCTACGCGTTTGCAGTACTTTTCTGCGTTCTTACTCGACCCACGGCAAGGGTGACCGTAAAGCTTTGAGTTTTGGAGAGCAAAAAATCAACCTGCATCAGGTTGGGAAGGAGTTTGAGCCTAAAGCCAATGCCCCAACACCAGGATCTGCTGACTTGTGCCTTATCACCAAAACCCCTCTGACAACTGTTGCTTCCCATCTCAAGGCATGTGGAGTGAAAATAGAGGAGGGCCCAGTTGACAGGACTGGCGCTGTGGGTCCCATCAGTTCCCTCTATTTTCGTGACCCTGACCACAACTTGATTGAAGTGTCCAATTACCAACAATAGACAGAAGGAGGCGCTGTATCATTGCCTGAAGATGAATATAAATCGCTCTGTAATTTGATGTTTTA

Function


symbol description
glod5 Orthologous to human GLOD5 (glyoxalase domain containing 5).

GO:

id name namespace
GO:0005575 cellular_component cellular_component

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
CI01000032_01634351_01638604.mRNA True 446 mRNA 0.46 3 1634351 1638669

Neighbor


gene id symbol gene type direction distance location
CI01000032_01614652_01616848 NA coding upstream 17377 1614437 ~ 1616974 (+)
CI01000032_01602807_01606708 NA coding upstream 27439 1602464 ~ 1606912 (+)
CI01000032_01540330_01542854 NA coding upstream 91462 1533402 ~ 1542889 (+)
CI01000032_01469232_01488085 NA coding upstream 145926 1468891 ~ 1488425 (+)
CI01000032_01441770_01450965 ZDHHC15, ZDHHC15B coding upstream 182628 1441009 ~ 1451723 (+)
CI01000032_01660248_01663865 NA coding downstream 21579 1660248 ~ 1664373 (+)
CI01000032_01698448_01701006 NA coding downstream 59779 1698448 ~ 1701288 (+)
CI01000032_01739954_01742737 NA coding downstream 101037 1739706 ~ 1742840 (+)
CI01000032_01743751_01746492 NA coding downstream 105082 1743751 ~ 1746516 (+)
CI01000032_02015472_02032776 FRMPD3 coding downstream 376803 2015472 ~ 2033649 (+)
G165650 NA non-coding upstream 121713 1480285 ~ 1512638 (+)
G165635 NA non-coding upstream 229151 1404954 ~ 1405200 (+)
G165629 NA non-coding upstream 233467 1400663 ~ 1400884 (+)
G165626 NA non-coding upstream 238407 1395686 ~ 1395944 (+)
G165619 NA non-coding upstream 251229 1382872 ~ 1383122 (+)
G165684 NA non-coding downstream 83347 1722016 ~ 1727504 (+)
G165725 NA non-coding downstream 233350 1872019 ~ 1886396 (+)
G165762 NA non-coding downstream 447365 2086034 ~ 2086320 (+)
G165763 NA non-coding downstream 447659 2086328 ~ 2086573 (+)
G165765 NA non-coding downstream 449244 2087913 ~ 2088126 (+)
G165570 NA other upstream 276784 1349578 ~ 1357567 (+)
CI01000032_02773889_02774396 NA other downstream 1120063 2773889 ~ 2774501 (+)
G166734 NA other downstream 1196645 2835314 ~ 2849684 (+)
G166765 NA other downstream 1318119 2956788 ~ 2957213 (+)

Expression



Co-expression Network


Homologous


species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_007159 glod5 coding NC_007125.7 CM002898.2 11395383 ~ 11399574 (+)