G165763


Basic Information

Item Value
gene id G165763
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000032
NCBI id null
chromosome length 4185905
location 2086328 ~ 2086573 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU188300
GACTCACTAATGTTCTAAGGGAGAATAGGCTCCGGTTCTTCATTGGTTTCTTCCGAGGTGTAGAGACGGGATAGGGCATCTGCCTTCACATTCTTGGGACCAGGACGACAGGAGATACTGAAGTGGAAACGTGTGAAGAACAGCACCCAACGAGCTTGGCGTGGGTTTAATCTCTTAGCATCTCTTAAGTACTCCAAGTTCTTATGGTCAGTGAGTACTGTAAATGGGTGCTTGGCACCCTCCAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU188300 True 246 lncRNA 0.48 1 2086328 2086573

Neighbor

gene id symbol gene type direction distance location
CI01000032_02015472_02032776 FRMPD3 coding upstream 52679 2015472 ~ 2033649 (+)
CI01000032_01743751_01746492 NA coding upstream 339812 1743751 ~ 1746516 (+)
CI01000032_01739954_01742737 NA coding upstream 343488 1739706 ~ 1742840 (+)
CI01000032_01698448_01701006 NA coding upstream 385279 1698448 ~ 1701288 (+)
CI01000032_01660248_01663865 NA coding upstream 421955 1660248 ~ 1664373 (+)
CI01000032_02130148_02154109 KCTD12B, KCTD12 coding downstream 43575 2130148 ~ 2154109 (+)
CI01000032_02201573_02204528 NA coding downstream 114898 2201471 ~ 2205605 (+)
CI01000032_02232176_02233727 NA coding downstream 145071 2231644 ~ 2233730 (+)
CI01000032_02308962_02317494 MYOT coding downstream 222389 2308962 ~ 2317494 (+)
CI01000032_02408022_02408243 NA coding downstream 321449 2408022 ~ 2408292 (+)
G165762 NA non-coding upstream 8 2086034 ~ 2086320 (+)
G165725 NA non-coding upstream 199932 1872019 ~ 1886396 (+)
G165684 NA non-coding upstream 358824 1722016 ~ 1727504 (+)
G165650 NA non-coding upstream 573690 1480285 ~ 1512638 (+)
G165635 NA non-coding upstream 681128 1404954 ~ 1405200 (+)
G165765 NA non-coding downstream 1340 2087913 ~ 2088126 (+)
G165766 NA non-coding downstream 2174 2088747 ~ 2089042 (+)
G165773 NA non-coding downstream 9897 2096470 ~ 2096747 (+)
G165707 NA non-coding downstream 22748 2109321 ~ 2112208 (+)
G165711 NA non-coding downstream 35098 2121671 ~ 2122503 (+)
G165570 NA other upstream 728761 1349578 ~ 1357567 (+)
CI01000032_02773889_02774396 NA other downstream 672159 2773889 ~ 2774501 (+)
G166734 NA other downstream 748741 2835314 ~ 2849684 (+)
G166765 NA other downstream 870215 2956788 ~ 2957213 (+)

Expression


Co-expression Network