CI01000034_05601190_05607136 (STAT5B, STAT5A, STAT5, STA5B)


Basic Information

Item Value
gene id CI01000034_05601190_05607136
gene name STAT5B, STAT5A, STAT5, STA5B
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000034
NCBI id null
chromosome length 5914002
location 5601132 ~ 5607169 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000034_05601190_05607136.mRNA
AAGTGCGACAAAATGGCTGTGTAGCTATCTAACATGCAAACCATAACCACATTTCAAAATGAATCCAATTTGAATTACCACAAACTAGTCGGAGATGCGGCCTGTACCTTTATCATCGAAAAGCAGCCTCCTCAGGTGCTGAAAACACAAACTAAATTTGCTGCGACAGTGCGTTTGCTGGTAGGTGGGAAACTCAACGTGCACATGAACCCACCGCAGGTCAAAGCCACCATCATCAGTGAACAACAGGCCAAGGCCCTGCTCAAGAATGAAAACACCAGAAATGACAGCAGTGGCGAGATCTTGAATAACAACTGTGTGATGGAGTACCACCAGACCACAGGCACCCTCAGCGCACACTTTAGAAACATGTCTCTGAAGCGGATCAGGCGTTCAGATCGCCGAGGGGCGGAGTCTGTTACAGAGGAGAAGTTCACCATTTTGTTTGAATCACAGTTCAGTGTTGGGGGAAATGAGCTGGTATTTCAGGTTAAGGGAAGGGTGCCCTTCATTGTGCCTGACAAGGTATTATGGCCGCAGTTGTGTGAGGCTCTGAATATGAAGTACAAGGCTGAAGTGCAGTCGAATCGTGGTCTGTCCGAGGAGAATCTCGTCTTCCTCGCTCAAAAAGCCTTCAGCAGCTCCAGCGTCAACCCGGAGGACTACCGCAACATGACCATGACCTGGTCACAGTTTAACAGGGTAAATACGCTACTCACTCTCAGCCACGGTAATAGACTGAATTTCTGTGTTTAGCAGGTCAACACTCTTCTGTAACATTTGTTTTTCCTTGTCCATCTCTACCAGGAAAAAA

Function

symbol description
stat5a Enables DNA binding activity and DNA-binding transcription factor activity. Acts upstream of or within several processes, including hemopoiesis; positive regulation of myeloid cell differentiation; and receptor signaling pathway via JAK-STAT. Predicted to be located in cytoplasm and nucleus. Is expressed in adaxial cell and liver. Human ortholog(s) of this gene implicated in growth hormone insensitivity syndrome with immune dysregulation 1 and growth hormone insensitivity syndrome with immune dysregulation 2. Orthologous to human STAT5A (signal transducer and activator of transcription 5A) and STAT5B (signal transducer and activator of transcription 5B).
stat5b Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in several processes, including cell surface receptor signaling pathway; defense response; and regulation of transcription by RNA polymerase II. Predicted to act upstream of or within regulation of transcription, DNA-templated and signal transduction. Predicted to be located in cytoplasm and nucleus. Human ortholog(s) of this gene implicated in growth hormone insensitivity syndrome with immune dysregulation 1 and growth hormone insensitivity syndrome with immune dysregulation 2. Orthologous to human STAT5A (signal transducer and activator of transcription 5A) and STAT5B (signal transducer and activator of transcription 5B).

GO:

id name namespace
GO:0006631 fatty acid metabolic process biological_process

KEGG:

id description
K11224 STAT5B; signal transducer and activator of transcription 5B

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000034_05601190_05607136.mRNA True 814 mRNA 0.47 5 5601132 5607169

Neighbor

gene id symbol gene type direction distance location
CI01000034_05509621_05566772 NA coding downstream 34360 5509621 ~ 5566772 (-)
CI01000034_05491347_05493196 NA coding downstream 107877 5491055 ~ 5493255 (-)
CI01000034_05467255_05480455 KCNH4, KCNH4A coding downstream 120677 5467255 ~ 5480455 (-)
CI01000034_05462429_05465076 NA coding downstream 136056 5462380 ~ 5465076 (-)
CI01000034_05441613_05448148 RAB5C, RAB5B coding downstream 152984 5441538 ~ 5448148 (-)
CI01000034_05681798_05699059 RBTSTAT3, STAT3 coding upstream 74324 5681493 ~ 5699120 (-)
CI01000034_05721684_05742044 NA coding upstream 114394 5721563 ~ 5742044 (-)
CI01000034_05744195_05777951 ATP6V0A1, ATP6V0A1A coding upstream 136855 5744024 ~ 5777951 (-)
CI01000034_05795972_05811363 NA coding upstream 188666 5795835 ~ 5811781 (-)
CI01000034_05833575_05834462 NA coding upstream 226234 5833403 ~ 5835139 (-)
G172776 NA non-coding downstream 23358 5577443 ~ 5577774 (-)
G172692 NA non-coding downstream 43157 5539885 ~ 5557975 (-)
G172696 NA non-coding downstream 65262 5528899 ~ 5535870 (-)
G172771 NA non-coding downstream 88336 5512528 ~ 5512796 (-)
G172680 NA non-coding downstream 384130 5211951 ~ 5217002 (-)
G172782 NA non-coding upstream 119212 5726381 ~ 5765635 (-)
G172800 NA non-coding upstream 182087 5789032 ~ 5789738 (-)
G172845 NA non-coding upstream 269562 5876731 ~ 5882670 (-)
G172593 NA other downstream 606189 4992960 ~ 4994943 (-)
CI01000034_04216451_04218876 NA other downstream 1383390 4216212 ~ 4221881 (-)
CI01000034_04165535_04172272 KCTD13 other downstream 1428962 4165373 ~ 4172272 (-)
G172151 NA other downstream 2203319 3391144 ~ 3451802 (-)
G172016 NA other downstream 2364517 3234963 ~ 3236615 (-)

Expression


Co-expression Network