G214007


Basic Information

Item Value
gene id G214007
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 2422791 ~ 2423073 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU242764
CGCACGAGCGCGAGATCTTGCTTTCCTGCCGCAGGCGTACCTCTCTCTGCGTCTGTTCTGTTCAGTGAGTGACTGAGAGGATCCTTCAGTTGAGGATGTGTGCTCTGTCAGAGAACAAATTTAAAATAGAGATACTATTGCTTCTAACCTGAGTGATCATTTTACATGTACAGGCAAAATCACAGCAAATGTCTTTATCTTATGGGTATGGTGATTTTGTCAGACAACGTCTCGATTACAAGTCAGGATTATAACATGTCAGGGCTCGACACTAACGCTTGTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU242764 True 283 lncRNA 0.44 1 2422791 2423073

Neighbor

gene id symbol gene type direction distance location
CI01000050_02407311_02413917 NA coding downstream 8874 2406440 ~ 2413917 (-)
CI01000050_02393197_02400057 LMO4A, LMO41 coding downstream 22734 2392836 ~ 2400057 (-)
CI01000050_02332320_02334175 BCL2L16 coding downstream 88616 2332179 ~ 2334175 (-)
CI01000050_02230904_02233429 NA coding downstream 189362 2228865 ~ 2233429 (-)
CI01000050_02213867_02218971 NA coding downstream 203805 2211730 ~ 2218986 (-)
CI01000050_02449354_02450013 NA coding upstream 26263 2449336 ~ 2450622 (-)
CI01000050_02488032_02496421 STAMBPB coding upstream 64638 2487711 ~ 2497255 (-)
CI01000050_02503125_02509915 NA coding upstream 79519 2502592 ~ 2510038 (-)
CI01000050_02528520_02596972 TCF7L1B, TCF7L1, TCF7L1A coding upstream 105447 2528520 ~ 2596972 (-)
CI01000050_02752537_02755836 COX5B.1, COX5B1, COX5B coding upstream 328959 2752032 ~ 2755922 (-)
G214005 NA non-coding downstream 577 2421991 ~ 2422214 (-)
G214000 NA non-coding downstream 3004 2419576 ~ 2419787 (-)
G213998 NA non-coding downstream 4022 2418537 ~ 2418769 (-)
G213988 NA non-coding downstream 55349 2367137 ~ 2367442 (-)
G213983 NA non-coding downstream 66602 2355856 ~ 2356189 (-)
G214009 NA non-coding upstream 532 2423605 ~ 2425469 (-)
G214034 NA non-coding upstream 17871 2440944 ~ 2441159 (-)
G214035 NA non-coding upstream 18474 2441547 ~ 2441841 (-)
G214036 NA non-coding upstream 24997 2448070 ~ 2448375 (-)
G214048 NA non-coding upstream 97217 2520290 ~ 2520715 (-)
G213948 NA other downstream 91475 2328513 ~ 2331316 (-)
G213704 NA other downstream 1105685 1312983 ~ 1317106 (-)
G213497 NA other downstream 1427132 983478 ~ 996539 (-)
G213429 NA other downstream 1592989 829342 ~ 829802 (-)
G214017 NA other upstream 39103 2462176 ~ 2464698 (-)
G214027 NA other upstream 134093 2557166 ~ 2572902 (-)
G214314 NA other upstream 990375 3413448 ~ 3424257 (-)
CI01000050_03491159_03514757 NA other upstream 1068263 3491088 ~ 3514757 (-)
G214436 NA other upstream 1102743 3525816 ~ 3589057 (-)

Expression


Co-expression Network