RNA id: TCONS_00025370


Basic Information

Item Value
RNA id TCONS_00025370
length 453
RNA type mRNA
GC content 0.50
exon number 4
gene id XLOC_012703
representative True

Chromosome Information

Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 16715864 ~ 16726206 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCACCATGATTCCTCCCAGCGCTCAGCCTCCACGAACACAAACTCCACCACTCGGACAGCCTCCTCAACTTGGACTGAAAACCAACCCGCCTCTGATTCAGGAGAAACCCCAGAAGACTACTAAAAAACCACCACCTGCTAGGGAGGAACTGCTGAAAATGACTGAGAACATTGTGACCGAGTATCTGAACAATAGGAACATGGAGGTCGCTGTCAGCGGTGTGAGAGAGATGAAAGCTCCCAAACACTTTCTGCCAGAGATGCTGAGTAAGATCATACTGTGTTCACTGGAAAGGACTGATGAAGACCGGGAACAGGCTAGCACTCTTATTAACACACTGCGTACCGAGGGCTTCATCACAGGGGAACACTTCATGCAGCAGGCTCTGCTGAATGTCTTGGATCAGTGCCCTAAGATTGAGGTAGACATCCCCCTGGTGAAGTCCTATCTAG

Function

GO:

id name namespace
GO:0007498 mesoderm development biological_process
GO:0016281 eukaryotic translation initiation factor 4F complex cellular_component
GO:0003723 RNA binding molecular_function
GO:0003729 mRNA binding molecular_function
GO:0003743 translation initiation factor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-6550 Predicted to enable mRNA binding activity and translation initiation factor activity. Acts upstream of or within mesoderm development. Predicted to be part of eukaryotic translation initiation factor 4F complex. Orthologous to human EIF4G2 (eukaryotic translation initiation factor 4 gamma 2).

Ensembl:

ensembl_id ENSDART00000146163

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00027078 lncRNA upstream 406318 16310121 ~ 16315811 (+) True XLOC_012700
TCONS_00025361 lncRNA upstream 528332 16192118 ~ 16193797 (+) True XLOC_012698
TCONS_00025359 lncRNA upstream 583774 16133708 ~ 16138355 (+) True XLOC_012697
TCONS_00027077 lncRNA upstream 1265382 15453915 ~ 15456747 (+) True XLOC_012684
TCONS_00027076 lncRNA upstream 1269477 15449505 ~ 15452652 (+) True XLOC_012683
TCONS_00027079 lncRNA downstream 75897 16798755 ~ 16862419 (+) False XLOC_012707
TCONS_00027080 lncRNA downstream 76197 16799055 ~ 16836065 (+) True XLOC_012707
TCONS_00026886 lncRNA downstream 218604 16941462 ~ 16941847 (+) True XLOC_012709
TCONS_00027081 lncRNA downstream 263232 16986090 ~ 16988214 (+) False XLOC_012712
TCONS_00027082 lncRNA downstream 455635 17178493 ~ 17180077 (+) True XLOC_012716
TCONS_00025365 mRNA upstream 279315 16426266 ~ 16442814 (+) True XLOC_012702
TCONS_00025364 mRNA upstream 382227 16330720 ~ 16339902 (+) True XLOC_012701
TCONS_00025363 mRNA upstream 382612 16330025 ~ 16339517 (+) False XLOC_012701
TCONS_00025362 mRNA upstream 467383 16246806 ~ 16254746 (+) True XLOC_012699
TCONS_00025360 mRNA upstream 503759 16192083 ~ 16218370 (+) False XLOC_012698
TCONS_00025371 mRNA downstream 21449 16744307 ~ 16748676 (+) False XLOC_012705
TCONS_00025372 mRNA downstream 21455 16744313 ~ 16747388 (+) True XLOC_012705
TCONS_00025373 mRNA downstream 26233 16749091 ~ 16756144 (+) False XLOC_012706
TCONS_00025374 mRNA downstream 27222 16750080 ~ 16752862 (+) True XLOC_012706
TCONS_00025375 mRNA downstream 217582 16940440 ~ 16950781 (+) False XLOC_012708
TCONS_00025369 other upstream 147 16721799 ~ 16721982 (+) True XLOC_012704
TCONS_00025367 other upstream 2939 16715951 ~ 16719190 (+) False XLOC_012703
TCONS_00025358 other upstream 581781 16133684 ~ 16140348 (+) False XLOC_012697
TCONS_00025343 other upstream 1009584 15712429 ~ 15712545 (+) True XLOC_012689
TCONS_00025333 other upstream 1725424 14989079 ~ 14996705 (+) True XLOC_012675
TCONS_00025380 other downstream 255770 16978628 ~ 16983066 (+) False XLOC_012711
TCONS_00025381 other downstream 255858 16978716 ~ 16983066 (+) False XLOC_012711
TCONS_00025382 other downstream 256707 16979565 ~ 16983066 (+) True XLOC_012711
TCONS_00025387 other downstream 349217 17072075 ~ 17074021 (+) True XLOC_012714
TCONS_00025397 other downstream 814453 17537311 ~ 17566512 (+) False XLOC_012723

Expression Profile

//