RNA id: TCONS_00025418


Basic Information

Item Value
RNA id TCONS_00025418
length 612
RNA type mRNA
GC content 0.48
exon number 4
gene id XLOC_012727
representative False

Chromosome Information

Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 17660158 ~ 17704546 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCGCGGGAAGCACTTTCTTCCTCTTTAACGTCGTTTACCATCTGATAAATCATAACTGGCATATATTATTATCTGGATGGATAGTGTAATCAACCCACAGACATTTTGAAGCGCACAGCTGCTGCCACATTACTACAAATAACGACAGAAGACGCTGAAGAAAAGTAAGGCTGCGCATTGCTTCGAGAGGGTGTAGGAGAGGAGGTACTCCCTTCTCCATGGCCTATACTCTGGGCTCGGGGCCCGATGTGGGTCCTGCATTAGGGCCCCAGCACTGCGTCACAAAAGTGGAGCTCTCAGTCTGCGGTGCTAACCTGCTGGACCGCGACGTAGCATCAAAATCAGACCCATTCTGTGTTCTTTTCCATGATGTGGACGGCAATTGGGTGGAGCTGGCTCGAACAGAGACGGCTATTAATAACCTGAATCCAGTATTTGGGGTAAAATTTCAAGTGGATTACCACTTTGAGGAGGTCCAGAAGCTGAAATTTGCCATGTTTGATGAGGACAAATGCAGCTCTCAGCTTTATGAACACGACTTTCTGGGCGAGTTCACCTGCACATTGGGAGTGATCGTGTCAAATAAGAAGCTGCATCGACCACTGATTCTGG

Function

GO:

id name namespace
GO:0071277 cellular response to calcium ion biological_process
GO:0005886 plasma membrane cellular_component
GO:0005544 calcium-dependent phospholipid binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-7896 Predicted to enable calcium-dependent phospholipid binding activity. Predicted to be involved in cellular response to calcium ion. Predicted to be active in plasma membrane. Orthologous to human CPNE2 (copine 2).

Ensembl:

ensembl_id ENSDART00000143475

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00025404 lncRNA upstream 74651 17583483 ~ 17585751 (+) True XLOC_012724
TCONS_00027083 lncRNA upstream 177178 17473975 ~ 17483224 (+) True XLOC_012719
TCONS_00027084 lncRNA upstream 183519 17476375 ~ 17476883 (+) True XLOC_012720
TCONS_00027082 lncRNA upstream 480325 17178493 ~ 17180077 (+) True XLOC_012716
TCONS_00027081 lncRNA upstream 672188 16986090 ~ 16988214 (+) False XLOC_012712
TCONS_00027085 lncRNA downstream 440500 18113043 ~ 18165017 (+) False XLOC_012734
TCONS_00027087 lncRNA downstream 440500 18113043 ~ 18226851 (+) False XLOC_012734
TCONS_00027086 lncRNA downstream 440500 18113043 ~ 18226851 (+) False XLOC_012734
TCONS_00027088 lncRNA downstream 440500 18113043 ~ 18249698 (+) False XLOC_012734
TCONS_00025437 lncRNA downstream 440500 18113043 ~ 18249698 (+) False XLOC_012734
TCONS_00025415 mRNA upstream 2600 17624296 ~ 17657802 (+) False XLOC_012726
TCONS_00025421 mRNA downstream 52867 17725410 ~ 17751843 (+) True XLOC_012729
TCONS_00025422 mRNA downstream 81967 17754510 ~ 17760150 (+) False XLOC_012730
TCONS_00025423 mRNA downstream 81971 17754514 ~ 17775588 (+) False XLOC_012730
TCONS_00025424 mRNA downstream 81974 17754517 ~ 17759502 (+) True XLOC_012730
TCONS_00025425 mRNA downstream 114005 17786548 ~ 17995062 (+) False XLOC_012731
TCONS_00025408 other upstream 51831 17600761 ~ 17608571 (+) False XLOC_012725
TCONS_00025409 other upstream 54607 17600946 ~ 17605795 (+) False XLOC_012725
TCONS_00025401 other upstream 80157 17580159 ~ 17580245 (+) True XLOC_012723
TCONS_00025397 other upstream 93890 17537311 ~ 17566512 (+) False XLOC_012723
TCONS_00025387 other upstream 586381 17072075 ~ 17074021 (+) True XLOC_012714
TCONS_00025420 other downstream 2797 17675340 ~ 17675455 (+) True XLOC_012728
TCONS_00025433 other downstream 291383 17963926 ~ 17994368 (+) True XLOC_012731
TCONS_00025438 other downstream 578956 18251499 ~ 18251615 (+) True XLOC_012735
TCONS_00025443 other downstream 1003159 18675702 ~ 18676884 (+) True XLOC_012739
TCONS_00025444 other downstream 1036506 18709049 ~ 18710155 (+) True XLOC_012740

Expression Profile

//