RNA id: TCONS_00030912



Basic Information


Item Value
RNA id TCONS_00030912
length 1077
RNA type mRNA
GC content 0.48
exon number 1
gene id XLOC_015457
representative True

Chromosome Information


Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 24931677 ~ 24932753 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


ATGGACAACGTCACTTCCGACTCCAACACGGGACTTGCCCTCGCCTGTAACATGACAGGACACCACAGTTTCATCTTCACCTTCATCCCAGTTGTCTACAGCTTCAACTTCATCATCGGACTCATAGGCAACAGTCTGGTAGTCGCCGTCATCTACTTCTGCTTAAAACTGAAGACAGTAGCCAACATATTTGTCTTCAATCTAGCCGTTTCAGACCTTACATTCCTCCTCACCCTTCCCATCTGGGCCATTTCCACTGCAACAGGCTACCATTGGCTTTTCGGAGACCTCCTATGTAAAACAATAGCTGGTATGGCTCTCCTAAATCTATATACTAGTATTTTTCTTCTCACTGCTCTCAGCGTTGACAGATATTTGGCTATCGTTCATCCTGTCCAGTCTAGACGCTGCCGTACGGTGATCTATGCCCGGGTAACATGCGTTCTAGTTTGGGTGGTATCATTTGGCCTAAGCTTGCCCACAGCCATCATCCGTGGGACCCATTTCATCCAGGACAACAATGTTACCGTATGCGCCATTCACCACAAAGAAGACATTCGTAATGTCCTTGCAGCTCTCAGTCTGATGAAGAGCGTTTTTGGCTTTCTTCTGCCTATCACCGTCATCCTCACGTGCTACTGCCTAATTGGTCGGGCTCTGCCTAAAGCAAGGGACATTCAGAGAAATGCCAGGTCAAACGGGGATGAGGTCTTGAACATGTTGGCTGCTGCCGCCCTGTCCTTTTTCCTTTGCTGGGCTCCCCATCAGATCTTCAACTTCATGGAGATGCTTCTCCTGCTGAAAGTCATCACTAGCTGTGACGTTGTGGACATCATTGATACTGGGATGCCATTCACCATTTGCATTGCCTTTTTCAACAGCTGCATGAATCCAATATTGTACAGTTTTGTTGGAAAGAACTTCCGGAGGAACTTGTTGAAGCTCTTAAGGTGCTCCTCGACGTCCGTGGCCTCTCATCCAGCCCTCAGCACTAAGATGAGCTCACTTTCATATCGAACTTCAGAGTTATCGCACCTCTCTGTCATTAAAACCCCTTCACTCCCTCGGGCCACATGA

Function


GO:

id name namespace
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0019229 regulation of vasoconstriction biological_process
GO:0007204 positive regulation of cytosolic calcium ion concentration biological_process
GO:0006954 inflammatory response biological_process
GO:0007165 signal transduction biological_process
GO:0005886 plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0004930 G protein-coupled receptor activity molecular_function
GO:0004945 angiotensin type II receptor activity molecular_function
GO:0001596 angiotensin type I receptor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070912-546 Predicted to enable angiotensin type I receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway; inflammatory response; and positive regulation of cytosolic calcium ion concentration. Predicted to act upstream of or within regulation of vasoconstriction and signal transduction. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in plasma membrane. Human ortholog(s) of this gene implicated in several diseases, including Alzheimer's disease; COVID-19; artery disease (multiple); chronic kidney disease; and sarcoidosis. Orthologous to human AGTR1 (angiotensin II receptor type 1).

Ensembl:

ensembl_id ENSDART00000021528

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00033263 lncRNA upstream 3923 24912293 ~ 24927754 (+) True XLOC_015456
TCONS_00033543 lncRNA upstream 25062 24903666 ~ 24906615 (+) True XLOC_015455
TCONS_00030903 lncRNA upstream 167089 24762638 ~ 24764588 (+) True XLOC_015450
TCONS_00033542 lncRNA upstream 210890 24716314 ~ 24720787 (+) True XLOC_015449
TCONS_00033541 lncRNA upstream 319609 24603292 ~ 24612068 (+) True XLOC_015446
TCONS_00030918 lncRNA downstream 197770 25130523 ~ 25137789 (+) True XLOC_015461
TCONS_00030924 lncRNA downstream 382905 25315658 ~ 25382341 (+) False XLOC_015463
TCONS_00030930 lncRNA downstream 901342 25834095 ~ 25836832 (+) True XLOC_015465
TCONS_00033544 lncRNA downstream 1233825 26166578 ~ 26167419 (+) True XLOC_015470
TCONS_00030948 lncRNA downstream 1356549 26289302 ~ 26290690 (+) True XLOC_015474
TCONS_00030911 mRNA upstream 44925 24885987 ~ 24886752 (+) True XLOC_015454
TCONS_00030909 mRNA upstream 52864 24867534 ~ 24878813 (+) False XLOC_015453
TCONS_00030910 mRNA upstream 53018 24868010 ~ 24878659 (+) True XLOC_015453
TCONS_00030906 mRNA upstream 65028 24786765 ~ 24866649 (+) False XLOC_015452
TCONS_00030907 mRNA upstream 68716 24819790 ~ 24862961 (+) False XLOC_015452
TCONS_00030913 mRNA downstream 4013 24936766 ~ 24944819 (+) True XLOC_015458
TCONS_00030914 mRNA downstream 86634 25019387 ~ 25108587 (+) False XLOC_015459
TCONS_00030915 mRNA downstream 142096 25074849 ~ 25104965 (+) False XLOC_015459
TCONS_00030916 mRNA downstream 142096 25074849 ~ 25105483 (+) True XLOC_015459
TCONS_00030917 mRNA downstream 191745 25124498 ~ 25129409 (+) True XLOC_015460
TCONS_00030908 other upstream 85678 24842587 ~ 24845999 (+) True XLOC_015452
TCONS_00030897 other upstream 390912 24540047 ~ 24540765 (+) False XLOC_015445
TCONS_00030898 other upstream 390952 24540209 ~ 24540725 (+) True XLOC_015445
TCONS_00030891 other upstream 433836 24484289 ~ 24497841 (+) True XLOC_015443
TCONS_00030885 other upstream 580637 24348589 ~ 24351040 (+) True XLOC_015440
TCONS_00030940 other downstream 1101422 26034175 ~ 26039606 (+) True XLOC_015468
TCONS_00030946 other downstream 1353712 26286465 ~ 26287505 (+) True XLOC_015473
TCONS_00030957 other downstream 1565781 26498534 ~ 26501294 (+) False XLOC_015477
TCONS_00030958 other downstream 1565808 26498561 ~ 26501275 (+) False XLOC_015477
TCONS_00030959 other downstream 1565809 26498562 ~ 26501305 (+) False XLOC_015477

Expression Profile


//