RNA id: TCONS_00032797


Basic Information

Item Value
RNA id TCONS_00032797
length 737
RNA type mRNA
GC content 0.52
exon number 1
gene id XLOC_016713
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 40901997 ~ 41124013 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ACAGCGATGTGTCGAGGACTTTAAACACACCGTGTCATACAGTGGTGAAAGGAGGGAGACCGCGCCGTGCTGGATCCTATACCGCAACACTTCTGATGCAATGAGTCCAACCTGACCCAATGCGTCTGACGACTGACTTTCAGCGCGCGATGCTCTGACTGCCGAGTGTTTATATGGAGACACCCTAAAAAACAGTCAACCGGGAAATGGTAACACATGAACCTCCTCACTGGAAGGAACATGGTTGAGAGGAGCAGTAAATTTCTGTTCATCGTTGTCGGCTCGGTTCTGTTCATGCTGATTTTGTATCAGTACGTGGCTCCGGGGATGATGAACTTCGGCTCTCCGCACGGCTACATGCTGGAAGACGATGCGGATCTCTTCCCGACTCCTGATCCCCATTACGTCAAGAAATTCTATTTCCCCATCAGGGATCTGGAGCGGACCGTGGATTTTGAAATCAAGGGGGATGATGTGATCGTGTTCCTCCACATCCAGAAGACCGGTGGGACCACGTTCGGGAGGCACCTGGTCCAGAACGTCAGGCTGGAGGTTCCGTGCGACTGTAGACCGGGACAGAAGAAGTGTACCTGTTACCGACCCAATAGGAAAGAAACCTGGCTCTTCTCACGGTTCTCCACCGGTTGGAGTTGTGGCTTACACGCGGACTGGACCGAACTGACCAACTGCGTACCGGGGGTTTTGAACAAAAAGGAGAGCAGGATGAAAAATCAAAG

Function

GO:

id name namespace
GO:0015015 heparan sulfate proteoglycan biosynthetic process, enzymatic modification biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0008146 sulfotransferase activity molecular_function
GO:0016740 transferase activity molecular_function
GO:0017095 heparan sulfate 6-O-sulfotransferase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050524-1 Enables heparan sulfate 6-O-sulfotransferase activity. Predicted to be involved in heparan sulfate proteoglycan biosynthetic process, enzymatic modification. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in several structures, including immature eye; nervous system; neural keel; neural tube; and polster. Human ortholog(s) of this gene implicated in hypogonadotropic hypogonadism 15 with or without anosmia. Orthologous to human HS6ST1 (heparan sulfate 6-O-sulfotransferase 1).

Ensembl:

ensembl_id ENSDART00000134756

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00032791 lncRNA downstream 318309 40786665 ~ 40804968 (-) True XLOC_016711
TCONS_00033389 lncRNA downstream 353473 40766601 ~ 40769804 (-) False XLOC_016710
TCONS_00033908 lncRNA downstream 353493 40767225 ~ 40769784 (-) True XLOC_016710
TCONS_00033388 lncRNA downstream 411060 40639420 ~ 40712217 (-) False XLOC_016709
TCONS_00033390 lncRNA upstream 38090 41162103 ~ 41447837 (-) False XLOC_016714
TCONS_00032798 lncRNA upstream 38090 41162103 ~ 41447837 (-) False XLOC_016714
TCONS_00033391 lncRNA upstream 38245 41162258 ~ 41447837 (-) False XLOC_016714
TCONS_00033910 lncRNA upstream 38372 41162385 ~ 41272468 (-) False XLOC_016714
TCONS_00033911 lncRNA upstream 109336 41233349 ~ 41235532 (-) True XLOC_016716
TCONS_00032794 mRNA downstream 233013 40830768 ~ 40890264 (-) False XLOC_016712
TCONS_00032795 mRNA downstream 233273 40832974 ~ 40890004 (-) True XLOC_016712
TCONS_00032793 mRNA downstream 233812 40830768 ~ 40889465 (-) False XLOC_016712
TCONS_00032792 mRNA downstream 233812 40830768 ~ 40889465 (-) False XLOC_016712
TCONS_00032784 mRNA downstream 931674 40181633 ~ 40191603 (-) True XLOC_016702
TCONS_00032801 mRNA upstream 380739 41504752 ~ 41518340 (-) True XLOC_016718
TCONS_00032802 mRNA upstream 422258 41546271 ~ 41562868 (-) True XLOC_016719
TCONS_00032803 mRNA upstream 439060 41563073 ~ 41571454 (-) True XLOC_016720
TCONS_00032804 mRNA upstream 453494 41577507 ~ 41620112 (-) False XLOC_016721
TCONS_00032805 mRNA upstream 456776 41580789 ~ 41620112 (-) False XLOC_016721
TCONS_00032788 other downstream 527783 40595375 ~ 40595494 (-) True XLOC_016708
TCONS_00032787 other downstream 578216 40544946 ~ 40545061 (-) True XLOC_016707
TCONS_00032779 other downstream 1053425 40067808 ~ 40069852 (-) False XLOC_016701
TCONS_00032777 other downstream 1096655 39926961 ~ 40026622 (-) False XLOC_016700
TCONS_00032799 other upstream 87965 41211978 ~ 41212094 (-) True XLOC_016715
TCONS_00032800 other upstream 297593 41421606 ~ 41421722 (-) True XLOC_016717
TCONS_00032808 other upstream 493194 41617207 ~ 41620112 (-) True XLOC_016721
TCONS_00032811 other upstream 821962 41945975 ~ 41946896 (-) True XLOC_016725
TCONS_00032833 other upstream 1247996 42372009 ~ 42375109 (-) True XLOC_016738

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000190_00502934_00503458.mRNA True 2500 mRNA 0.38 1 CI01000190 501376 ~ 503875 (+)