RNA id: TCONS_00037588



Basic Information


Item Value
RNA id TCONS_00037588
length 624
RNA type mRNA
GC content 0.49
exon number 6
gene id XLOC_018915
representative True

Chromosome Information


Item Value
chromosome id NC_007132.7
NCBI id CM002905.2
chromosome length 45934066
location 23108420 ~ 23131600 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


CTAAACCAACTCACCCGGTTACTGCTTCGCAAATACAACTGTGGAGTTCGGCCTGTCCAGAACTGGACTAAACCCACTACAATTTACATTGACCTTATCATCCAGGCTGTCCTGGATGTGGACGGACAGACTCAAAAAGTGACCACCAGCATCTGGTATCGCCAAATATGGAACGATGAGTTTCTTGTTTGGGATCCTGACGAGTTTGATGGAATCACTGAAATATCGCTGTCCTCGGATGCCATCTGGGTGCCTGATCTCATCATAAGTGAATTTGTTGATGTTGGCAAATCCCCAGTCATCCCATATGTTTATGTCAACTGCTCAGGAAAAGTAAAAAACTACAAACCCATCCAGGTGGTCTCAGCCTGTCACCTGGAGATTTACGCCTTTCCTTTTGACAAGCAGAACTGCACTCTGACCTTTCGCAGCTGGCTCCATTCAGTGAGCGAAGTGGATTTGGCTCTATGGAGGCCTGCTGAGGAAATCGCCAACGACACCAGAGAGTTCATGAATGATGGAGAATGGGAGCTGCTCGGCGTCCCTTCACGCTACTGGACATTGAATCTAGAGGACAGAGACTACGCACAGATTCAGTTTAATGTGCTGATCCGCCGGCGCCCC

Function


GO:

id name namespace
GO:0042391 regulation of membrane potential biological_process
GO:0050877 nervous system process biological_process
GO:0034220 ion transmembrane transport biological_process
GO:0007268 chemical synaptic transmission biological_process
GO:0006811 ion transport biological_process
GO:0007165 signal transduction biological_process
GO:0043005 neuron projection cellular_component
GO:0045202 synapse cellular_component
GO:0005887 integral component of plasma membrane cellular_component
GO:0045211 postsynaptic membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0022850 serotonin-gated cation-selective channel activity molecular_function
GO:0015276 ligand-gated ion channel activity molecular_function
GO:0004888 transmembrane signaling receptor activity molecular_function
GO:0005216 ion channel activity molecular_function
GO:0005230 extracellular ligand-gated ion channel activity molecular_function
GO:0030594 neurotransmitter receptor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-071012-4 Predicted to enable serotonin-gated cation-selective channel activity. Predicted to be involved in several processes, including chemical synaptic transmission; ion transmembrane transport; and regulation of membrane potential. Predicted to act upstream of or within ion transport. Predicted to be located in postsynaptic membrane. Predicted to be integral component of membrane. Predicted to be active in neuron projection and synapse. Predicted to be integral component of plasma membrane. Human ortholog(s) of this gene implicated in alcohol use disorder and mental depression. Orthologous to human HTR3B (5-hydroxytryptamine receptor 3B).

Ensembl:

ensembl_id ENSDART00000134019

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00039403 lncRNA upstream 60997 23048537 ~ 23051547 (+) False XLOC_018914
TCONS_00039404 lncRNA upstream 60997 23050430 ~ 23051547 (+) True XLOC_018914
TCONS_00037583 lncRNA upstream 226652 22884945 ~ 22885892 (+) True XLOC_018911
TCONS_00037574 lncRNA upstream 329312 22777080 ~ 22783232 (+) True XLOC_018907
TCONS_00039402 lncRNA upstream 379437 22720214 ~ 22733107 (+) True XLOC_018906
TCONS_00039405 lncRNA downstream 33795 23160137 ~ 23164204 (+) False XLOC_018917
TCONS_00039406 lncRNA downstream 33795 23160137 ~ 23164308 (+) True XLOC_018917
TCONS_00039407 lncRNA downstream 179184 23305526 ~ 23308245 (+) True XLOC_018918
TCONS_00037598 lncRNA downstream 1296856 24423198 ~ 24438842 (+) False XLOC_018922
TCONS_00037597 lncRNA downstream 1296856 24423198 ~ 24438842 (+) False XLOC_018922
TCONS_00037585 mRNA upstream 126267 22985078 ~ 22986277 (+) True XLOC_018913
TCONS_00037584 mRNA upstream 211137 22892836 ~ 22901407 (+) True XLOC_018912
TCONS_00037581 mRNA upstream 224169 22878834 ~ 22888375 (+) False XLOC_018911
TCONS_00037582 mRNA upstream 232308 22878991 ~ 22880236 (+) False XLOC_018911
TCONS_00037580 mRNA upstream 234671 22872726 ~ 22877873 (+) True XLOC_018910
TCONS_00037589 mRNA downstream 8980 23135322 ~ 23156308 (+) False XLOC_018916
TCONS_00037590 mRNA downstream 9053 23135395 ~ 23146551 (+) True XLOC_018916
TCONS_00037594 mRNA downstream 826839 23953181 ~ 24412427 (+) False XLOC_018920
TCONS_00037593 mRNA downstream 826839 23953181 ~ 24412427 (+) False XLOC_018920
TCONS_00037592 mRNA downstream 826839 23953181 ~ 24412427 (+) False XLOC_018920
TCONS_00037570 other upstream 449980 22636887 ~ 22662564 (+) True XLOC_018904
TCONS_00037569 other upstream 475135 22635414 ~ 22637409 (+) False XLOC_018904
TCONS_00037551 other upstream 1076367 22036061 ~ 22036177 (+) True XLOC_018892
TCONS_00037550 other upstream 1192335 21920077 ~ 21920209 (+) True XLOC_018891
TCONS_00037548 other upstream 1202750 21894067 ~ 21909794 (+) False XLOC_018890
TCONS_00037591 other downstream 558378 23684720 ~ 23684836 (+) True XLOC_018919
TCONS_00037595 other downstream 1109809 24236151 ~ 24236272 (+) True XLOC_018921
TCONS_00037602 other downstream 1421182 24547524 ~ 24547600 (+) True XLOC_018926
TCONS_00037603 other downstream 1541879 24668221 ~ 24668337 (+) True XLOC_018927
TCONS_00037604 other downstream 1623320 24749662 ~ 24749779 (+) True XLOC_018928

Expression Profile


//