RNA id: TCONS_00037590



Basic Information


Item Value
RNA id TCONS_00037590
length 1212
RNA type mRNA
GC content 0.48
exon number 8
gene id XLOC_018916
representative True

Chromosome Information


Item Value
chromosome id NC_007132.7
NCBI id CM002905.2
chromosome length 45934066
location 23135322 ~ 23156308 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


AATGGAGTTCAGCCTGCATCACTAGATGGAAGCAGCACCAGGCTAGAAGAACAGTTATAGAGCAACTGCGAATCGCTCAGCACAATGAGAAGTTCAGCACTCTGGACAGCTCTCTGCATATGCATGTATGGCACAGTGGTGGATTGCTCAGTGAAGAAGCTTGGCAATAACACTGGGCGTTTCGCCAATGCCACTCTGGTTCGGCTAAATGAGTTTTTAAGTGCCGGATATAAAAAAGGAGTTCGACCTGTGCGCGACTGGAGGCAGTCAACGACGGTGGCAATTGACCTTATGGTTTATGCCATTCTCAATGTGGATGAGAAGAACCAGGTTTTGACAACATATGTGTGGTACAGACAGCAATGGACAGATGAGTTCCTTATGTGGGATCCTGAGGAATTTGATGAAGTCAAAAAAATTTCCATTCCGACTGCCAACATCTGGATTCCAGATATCCTCATCAATGAATTTGTTGATGTAGGAAAGTCTCCTGATATTCCTTATGTCTACGTAGGCCATGATGGACTTGTCAGCAACTATAAGCCTATCCAAGTAGTGACTGCCTGCTCTCTCAACATCTATAACTTTCCTTATGATGTTCAAAAATGTAGCTTGACTTTCCAGAGCTGGCTACACACAACTAAAGACATCAACATCACACTAATGAGAAGCCCTGAGGCTGTCAAGACAGACAAGAGTGTGTTCATGAACCAGGGAGAATGGGAGCTGCTTCACGTCCTCTCCACATACAACGCGTTCAGCATTGATAATGATGATTACTACGCCGAAATGAAGTTCCATGTTGTGATCCGGCGCAGACCTCTTTTCTACACAGTCAACCTCCTGCTGCCCAGTATGTTTCTGATGGTGATGGATATTGTTGGCTTCTACCTGCCGCCTGACAGCGGAGAGCGAGTGTCCTTCAAGATCACCCTGCTTCTGGGCTACTCCGTGTTCCTCATCATTGTCTCTGACACTCTGCCAGCCACTGCCATCGGGACTCCTCTCATCGGTGTGTACTTTGTGGTCTGCATGGCGCTGCTGGTCATCAGTCTGACCGAGTCAGTGTTGATCGTGAGGCTGGTGCACAAGCAGGATCTGCAGTCCCGTGTGCCACAGTGGGTCAAACACCTGGTGCTGGAGAAGGCCACAGTCCTGCTCTGCATTCGCAACAAGAAGATCTGCTCGTTCCGCTCACAGGGGTCCGACCTG

Function


GO:

id name namespace
GO:0042391 regulation of membrane potential biological_process
GO:0050877 nervous system process biological_process
GO:0034220 ion transmembrane transport biological_process
GO:0007268 chemical synaptic transmission biological_process
GO:0006811 ion transport biological_process
GO:0007165 signal transduction biological_process
GO:0043005 neuron projection cellular_component
GO:0045202 synapse cellular_component
GO:0005887 integral component of plasma membrane cellular_component
GO:0045211 postsynaptic membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0022850 serotonin-gated cation-selective channel activity molecular_function
GO:0015276 ligand-gated ion channel activity molecular_function
GO:0004888 transmembrane signaling receptor activity molecular_function
GO:0005216 ion channel activity molecular_function
GO:0005230 extracellular ligand-gated ion channel activity molecular_function
GO:0030594 neurotransmitter receptor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-071012-5 Predicted to enable serotonin-gated cation-selective channel activity. Predicted to be involved in several processes, including chemical synaptic transmission; ion transmembrane transport; and regulation of membrane potential. Predicted to act upstream of or within ion transport. Predicted to be located in postsynaptic membrane. Predicted to be integral component of membrane. Predicted to be active in neuron projection and synapse. Predicted to be integral component of plasma membrane. Human ortholog(s) of this gene implicated in irritable bowel syndrome. Orthologous to human HTR3A (5-hydroxytryptamine receptor 3A).

Ensembl:

ensembl_id ENSDART00000125907

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00039403 lncRNA upstream 83848 23048537 ~ 23051547 (+) False XLOC_018914
TCONS_00039404 lncRNA upstream 83848 23050430 ~ 23051547 (+) True XLOC_018914
TCONS_00037583 lncRNA upstream 249503 22884945 ~ 22885892 (+) True XLOC_018911
TCONS_00037574 lncRNA upstream 352163 22777080 ~ 22783232 (+) True XLOC_018907
TCONS_00039402 lncRNA upstream 402288 22720214 ~ 22733107 (+) True XLOC_018906
TCONS_00039405 lncRNA downstream 13586 23160137 ~ 23164204 (+) False XLOC_018917
TCONS_00039406 lncRNA downstream 13586 23160137 ~ 23164308 (+) True XLOC_018917
TCONS_00039407 lncRNA downstream 158975 23305526 ~ 23308245 (+) True XLOC_018918
TCONS_00037598 lncRNA downstream 1276647 24423198 ~ 24438842 (+) False XLOC_018922
TCONS_00037597 lncRNA downstream 1276647 24423198 ~ 24438842 (+) False XLOC_018922
TCONS_00037587 mRNA upstream 3795 23108420 ~ 23131600 (+) False XLOC_018915
TCONS_00037586 mRNA upstream 3795 23108420 ~ 23131600 (+) False XLOC_018915
TCONS_00037588 mRNA upstream 9053 23112544 ~ 23126342 (+) True XLOC_018915
TCONS_00037585 mRNA upstream 149118 22985078 ~ 22986277 (+) True XLOC_018913
TCONS_00037584 mRNA upstream 233988 22892836 ~ 22901407 (+) True XLOC_018912
TCONS_00037594 mRNA downstream 806630 23953181 ~ 24412427 (+) False XLOC_018920
TCONS_00037593 mRNA downstream 806630 23953181 ~ 24412427 (+) False XLOC_018920
TCONS_00037592 mRNA downstream 806630 23953181 ~ 24412427 (+) False XLOC_018920
TCONS_00037596 mRNA downstream 1140852 24287403 ~ 24412427 (+) True XLOC_018920
TCONS_00037599 mRNA downstream 1389682 24536233 ~ 24537058 (+) False XLOC_018925
TCONS_00037570 other upstream 472831 22636887 ~ 22662564 (+) True XLOC_018904
TCONS_00037569 other upstream 497986 22635414 ~ 22637409 (+) False XLOC_018904
TCONS_00037551 other upstream 1099218 22036061 ~ 22036177 (+) True XLOC_018892
TCONS_00037550 other upstream 1215186 21920077 ~ 21920209 (+) True XLOC_018891
TCONS_00037548 other upstream 1225601 21894067 ~ 21909794 (+) False XLOC_018890
TCONS_00037591 other downstream 538169 23684720 ~ 23684836 (+) True XLOC_018919
TCONS_00037595 other downstream 1089600 24236151 ~ 24236272 (+) True XLOC_018921
TCONS_00037602 other downstream 1400973 24547524 ~ 24547600 (+) True XLOC_018926
TCONS_00037603 other downstream 1521670 24668221 ~ 24668337 (+) True XLOC_018927
TCONS_00037604 other downstream 1603111 24749662 ~ 24749779 (+) True XLOC_018928

Expression Profile


//