RNA id: TCONS_00053829


Basic Information

Item Value
RNA id TCONS_00053829
length 415
RNA type mRNA
GC content 0.57
exon number 4
gene id XLOC_027358
representative True

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 25912308 ~ 25946970 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGAAGATCCAGGACCAGAGCAAGAGATGTGCGAGAGAATTCTCCACTGTTCCAGTATTTGCAGGATTTAGGACACACAGATTTTGAGGCATGTACTCCCGTTTCTCAAGAGGAGGAGCCCGGCGCTGGAGGAGAGGAGGCTCCGTTTCCTCAGGATATCCTCCAGTCCCGTACAAGTGGTGTTTGGAGGCTGGTTGATGCTCTGCGGGGTCTCAATCCTCTGCGTCGAGACAGCGCCACCCACTGGCAGGAGCAGCAGCTGGATTCTGCTTTCCGCCAGTCATCTCTGCGATGTCTGCTGTCTCAGGATGTCCTGCTGCAGGAGGACGTGGAGCTGATCGAGCTGCTGGACCCCAGTGTTCTCTCACTGGGCTCTGCTGACACTGTCTGTCCCAGTGCTGCTGTGCCTGCACCGC

Function

GO:

id name namespace
GO:0098609 cell-cell adhesion biological_process
GO:0017022 myosin binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070705-251 Predicted to enable myosin binding activity. Predicted to be involved in cell-cell adhesion. Predicted to be located in adherens junction; membrane; and nucleus. Predicted to be integral component of membrane. Predicted to be active in plasma membrane. Orthologous to human VEZT (vezatin, adherens junctions transmembrane protein).

Ensembl:

ensembl_id ENSDART00000138603

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00057736 lncRNA upstream 162566 25754037 ~ 25755349 (+) True XLOC_027357
TCONS_00057735 lncRNA upstream 828068 25084095 ~ 25089847 (+) True XLOC_027345
TCONS_00057153 lncRNA upstream 901647 25014049 ~ 25016268 (+) True XLOC_027344
TCONS_00057152 lncRNA upstream 1159134 24758348 ~ 24758781 (+) True XLOC_027343
TCONS_00057734 lncRNA upstream 2029121 23880394 ~ 23888794 (+) True XLOC_027342
TCONS_00053838 lncRNA downstream 430365 26357467 ~ 26359451 (+) True XLOC_027362
TCONS_00053841 lncRNA downstream 569401 26496503 ~ 26572656 (+) False XLOC_027364
TCONS_00057737 lncRNA downstream 904153 26831255 ~ 26836675 (+) True XLOC_027366
TCONS_00053854 lncRNA downstream 1173452 27100554 ~ 27108787 (+) True XLOC_027369
TCONS_00053863 lncRNA downstream 2437161 28364263 ~ 28371438 (+) True XLOC_027373
TCONS_00053823 mRNA upstream 166554 25704579 ~ 25751361 (+) False XLOC_027356
TCONS_00053824 mRNA upstream 166638 25706037 ~ 25751277 (+) True XLOC_027356
TCONS_00053820 mRNA upstream 213851 25691642 ~ 25704064 (+) False XLOC_027355
TCONS_00053822 mRNA upstream 213851 25693463 ~ 25704064 (+) True XLOC_027355
TCONS_00053821 mRNA upstream 213853 25692277 ~ 25704062 (+) False XLOC_027355
TCONS_00053830 mRNA downstream 23270 25950372 ~ 26016541 (+) True XLOC_027359
TCONS_00053831 mRNA downstream 109580 26036682 ~ 26051118 (+) True XLOC_027360
TCONS_00053832 mRNA downstream 125942 26053044 ~ 26082119 (+) False XLOC_027361
TCONS_00053833 mRNA downstream 129446 26056548 ~ 26078229 (+) True XLOC_027361
TCONS_00053835 mRNA downstream 430119 26357221 ~ 26362129 (+) False XLOC_027362
TCONS_00053811 other upstream 308404 25607102 ~ 25609511 (+) False XLOC_027351
TCONS_00053789 other upstream 2538537 23379262 ~ 23379378 (+) True XLOC_027338
TCONS_00053784 other upstream 2783379 23132542 ~ 23134536 (+) False XLOC_027335
TCONS_00053781 other upstream 2785391 23127204 ~ 23132524 (+) False XLOC_027335
TCONS_00053842 other downstream 643596 26570698 ~ 26570813 (+) True XLOC_027365
TCONS_00053851 other downstream 1173426 27100528 ~ 27106507 (+) False XLOC_027369
TCONS_00053853 other downstream 1173452 27100554 ~ 27105396 (+) False XLOC_027369
TCONS_00053858 other downstream 2188505 28115607 ~ 28115721 (+) True XLOC_027372
TCONS_00053865 other downstream 2457335 28384437 ~ 28407131 (+) True XLOC_027375