RNA id: TCONS_00060168



Basic Information


Item Value
RNA id TCONS_00060168
length 614
RNA type processed_transcript
GC content 0.51
exon number 5
gene id XLOC_030953
representative True

Chromosome Information


Item Value
chromosome id NC_007116.7
NCBI id CM002889.2
chromosome length 72500376
location 19385503 ~ 19400166 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


AGACACACAAAATAACTGAAAAGTGAGGGTTGTCATAGCGACCCCAATTATTGCACTGAATAGAGAGTTTGTAGGGAAGTCTGGAGAGAATTCAAGATGGTTTCTCTGCTCTCTTGATGCTTAGAGCAAATGAAGAAATGGCTGAGTAAATAACTCTCCCTGCGCTGGATTAGATCTGAGGAGACTCCTGACTACAGACCCTTCGCAGCTGAAGGACGAACTGCCTGGTGATCTTCAATCTCTGTCCTGGCTCACCTCTGTGGATGTTCCCCGACTGCAGCAGATTGGGGGTGGACGGCCAGATTTCACTAGCTCTGCTCAAAGCAGCCTACTGGAGCGACAGACAGCTCAGTTGAACAGCATGACGGTAGCAGGAGGAGCAGGATCTGCGATTCATCTACAGAGTGAAATGCAGCACAGCCCTCTGGCCATCAACAGCATGCCCCAGTTTTCCCCTGGGTTTCCGTGTGCCGCATCAGTGTACCAGACGGCTCCTCAGCAGGTGCTCACTTTCACCCAAGCAAACCAACAGTGTTCACCCGGTGGACTGTATGGAAACTACAACAGCCAGAATTTGTTTCCTCAACCCCGGATTACTGCTCACAGCCAGGACC

Function


GO:

id name namespace
GO:0036302 atrioventricular canal development biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0007275 multicellular organism development biological_process
GO:0003170 heart valve development biological_process
GO:0035881 amacrine cell differentiation biological_process
GO:0045893 positive regulation of transcription, DNA-templated biological_process
GO:0008016 regulation of heart contraction biological_process
GO:0007399 nervous system development biological_process
GO:0010842 retina layer formation biological_process
GO:0001947 heart looping biological_process
GO:0060579 ventral spinal cord interneuron fate commitment biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003682 chromatin binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000987 cis-regulatory region sequence-specific DNA binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-990415-277 Enables DNA-binding transcription factor activity and sequence-specific DNA binding activity. Involved in atrioventricular canal development and heart looping. Acts upstream of or within heart valve development; positive regulation of transcription, DNA-templated; and regulation of heart contraction. Predicted to be active in nucleus. Is expressed in several structures, including forebrain neural keel; nervous system; optic vesicle; pericardial region; and presumptive neural retina. Orthologous to human FOXN4 (forkhead box N4).

Ensembl:

ensembl_id ENSDART00000127346

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00061973 lncRNA downstream 55899 19334206 ~ 19335668 (-) False XLOC_030952
TCONS_00061972 lncRNA downstream 75919 19312775 ~ 19315648 (-) True XLOC_030951
TCONS_00061971 lncRNA downstream 607133 18783738 ~ 18784434 (-) True XLOC_030942
TCONS_00061968 lncRNA downstream 966930 18317903 ~ 18424637 (-) False XLOC_030940
TCONS_00060171 lncRNA upstream 46969 19442678 ~ 19444949 (-) True XLOC_030954
TCONS_00061974 lncRNA upstream 564971 19960680 ~ 19963521 (-) False XLOC_030959
TCONS_00060177 lncRNA upstream 564971 19960680 ~ 19963556 (-) True XLOC_030959
TCONS_00061975 lncRNA upstream 709299 20105008 ~ 20109265 (-) True XLOC_030961
TCONS_00061976 lncRNA upstream 893650 20289359 ~ 20297439 (-) True XLOC_030967
TCONS_00060161 mRNA downstream 339383 19021786 ~ 19052184 (-) False XLOC_030950
TCONS_00060162 mRNA downstream 355403 19022702 ~ 19036164 (-) False XLOC_030950
TCONS_00060158 mRNA downstream 376978 19006701 ~ 19014589 (-) False XLOC_030948
TCONS_00060157 mRNA downstream 385277 18965494 ~ 19006290 (-) True XLOC_030947
TCONS_00060155 mRNA downstream 429850 18943474 ~ 18961717 (-) False XLOC_030946
TCONS_00060169 mRNA upstream 40774 19436483 ~ 19444930 (-) False XLOC_030954
TCONS_00060170 mRNA upstream 40776 19436485 ~ 19444930 (-) False XLOC_030954
TCONS_00060173 mRNA upstream 93872 19489581 ~ 19494048 (-) True XLOC_030955
TCONS_00060174 mRNA upstream 400268 19795977 ~ 19833310 (-) True XLOC_030956
TCONS_00060175 mRNA upstream 455119 19850828 ~ 19861766 (-) True XLOC_030957
TCONS_00060165 other downstream 55040 19334206 ~ 19336527 (-) True XLOC_030952
TCONS_00060164 other downstream 339070 19051905 ~ 19052497 (-) True XLOC_030950
TCONS_00060163 other downstream 358911 19025777 ~ 19032656 (-) False XLOC_030950
TCONS_00060160 other downstream 377633 19010429 ~ 19013934 (-) True XLOC_030948
TCONS_00060159 other downstream 382793 19008646 ~ 19008774 (-) True XLOC_030949
TCONS_00060172 other upstream 93872 19489581 ~ 19492515 (-) False XLOC_030955
TCONS_00060180 other upstream 720492 20116201 ~ 20121024 (-) True XLOC_030962
TCONS_00060186 other upstream 1013127 20408836 ~ 20408952 (-) True XLOC_030968
TCONS_00060189 other upstream 1048517 20444226 ~ 20445673 (-) False XLOC_030970
TCONS_00060188 other upstream 1048517 20444226 ~ 20445673 (-) True XLOC_030970

Expression Profile


//