RNA id: TCONS_00008094


Basic Information

Item Value
RNA id TCONS_00008094
length 207
RNA type mRNA
GC content 0.39
exon number 2
gene id XLOC_004239
representative True

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 34151177 ~ 34151487 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGGAGATTTTTTTTCGGTCTGAATGAAATTGATGTGAAAGTGCCTTCTCTTTTCAAGCTGCTAATTAAGGAGGTCCTCAATCCTTTCTACATCTTCCAGCTCTTCAGTGTTGTTCTGTGGTGTACAGATGAATACTATTACTACGCAATGGCCATAGTCGTCATGTCCTTCATATCAATAGCTACCTCTCTCTACACTATTAAAAAG

Function

GO:

id name namespace
GO:0006812 cation transport biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0016887 ATPase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-120521-1 Predicted to enable ATP binding activity and metal ion binding activity. Predicted to act upstream of or within cation transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human ATP13A3 (ATPase 13A3).

Ensembl:

ensembl_id ENSDART00000173039

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00008482 lncRNA downstream 158030 33992033 ~ 33993147 (-) True XLOC_004235
TCONS_00008832 lncRNA downstream 462228 33676834 ~ 33688949 (-) True XLOC_004229
TCONS_00008831 lncRNA downstream 465266 33676834 ~ 33685911 (-) False XLOC_004229
TCONS_00008481 lncRNA downstream 749701 33344982 ~ 33401476 (-) False XLOC_004227
TCONS_00008480 lncRNA downstream 806720 33339539 ~ 33344457 (-) False XLOC_004227
TCONS_00008099 lncRNA upstream 68863 34220350 ~ 34225557 (-) False XLOC_004242
TCONS_00008100 lncRNA upstream 71406 34222893 ~ 34225798 (-) True XLOC_004242
TCONS_00008101 lncRNA upstream 97969 34249456 ~ 34255220 (-) True XLOC_004243
TCONS_00008833 lncRNA upstream 164038 34315525 ~ 34358689 (-) True XLOC_004244
TCONS_00008834 lncRNA upstream 399360 34550847 ~ 34577001 (-) False XLOC_004249
TCONS_00008092 mRNA downstream 3972 34116734 ~ 34147205 (-) False XLOC_004238
TCONS_00008093 mRNA downstream 26858 34118359 ~ 34124319 (-) True XLOC_004238
TCONS_00008091 mRNA downstream 53740 34091410 ~ 34097437 (-) True XLOC_004237
TCONS_00008090 mRNA downstream 53759 34084532 ~ 34097418 (-) False XLOC_004237
TCONS_00008089 mRNA downstream 85459 33996526 ~ 34065718 (-) True XLOC_004236
TCONS_00008095 mRNA upstream 3106 34154593 ~ 34188346 (-) False XLOC_004240
TCONS_00008096 mRNA upstream 6691 34158178 ~ 34166960 (-) True XLOC_004240
TCONS_00008097 mRNA upstream 49696 34201183 ~ 34219211 (-) True XLOC_004241
TCONS_00008098 mRNA upstream 68504 34219991 ~ 34232906 (-) False XLOC_004242
TCONS_00008103 mRNA upstream 249973 34401460 ~ 34480822 (-) False XLOC_004246
TCONS_00008088 other downstream 184905 33966158 ~ 33966272 (-) True XLOC_004234
TCONS_00008078 other downstream 779810 33371251 ~ 33371367 (-) True XLOC_004227
TCONS_00008075 other downstream 1413584 32731165 ~ 32737593 (-) True XLOC_004221
TCONS_00008067 other downstream 2978923 31170349 ~ 31172254 (-) True XLOC_004210
TCONS_00008056 other downstream 3642386 30424226 ~ 30508791 (-) True XLOC_004205
TCONS_00008102 other upstream 204057 34355544 ~ 34355662 (-) True XLOC_004245
TCONS_00008105 other upstream 314908 34466395 ~ 34466513 (-) True XLOC_004247
TCONS_00008119 other upstream 1073535 35225022 ~ 35225139 (-) True XLOC_004254
TCONS_00008174 other upstream 3147884 37299371 ~ 37299485 (-) True XLOC_004279
TCONS_00008194 other upstream 4023584 38175071 ~ 38175150 (-) True XLOC_004294

Expression Profile

//