G243565



Basic Information


Item Value
gene id G243565
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 970391 ~ 970672 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU276430
ACACGCGCTACTGATAGGCTCGGAGCCATCGAGGGCTTGCCCGACTGAACACCGCATCAAACAGCCTGAAGTACGCAGTTAGGAAAGGCATCATGTGGGTCTCACGTTTTTAGCCTGCATCACACTGGTTTGGATGTAGGTCATGTGCCTAAAATAGCTACCCATATTTTGGTAAAATAATGTTTGATGTTTGGAGAACTCTAACTAAACAATGATGTTTAGAAACATGTCTATATAACGCTATTACTAGAGAAATGTGCCTGTATAGGCTACACGTCAAAA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU276430 True 282 lncRNA 0.43 1 970391 970672

Neighbor


gene id symbol gene type direction distance location
CI01000057_00900531_00930709 RBMS2A, RBMS2B, RBMS2 coding upstream 38943 899354 ~ 931448 (+)
CI01000057_00852993_00854987 NA coding upstream 115222 852993 ~ 855169 (+)
CI01000057_00713870_00835798 LRP1 coding upstream 134365 713823 ~ 836026 (+)
CI01000057_00704214_00707893 NA coding upstream 262488 704129 ~ 707903 (+)
CI01000057_00631558_00652724 NA coding upstream 317657 630531 ~ 652734 (+)
CI01000057_01058821_01071240 RARGB, RARGA, RARG coding downstream 86864 1057536 ~ 1071388 (+)
CI01000057_01115280_01118124 NA coding downstream 144608 1115280 ~ 1118309 (+)
CI01000057_01131299_01132358 NA coding downstream 158739 1129411 ~ 1134228 (+)
CI01000057_01139343_01141069 HOXC11B coding downstream 168367 1139039 ~ 1141438 (+)
CI01000057_01165517_01166589 HOXC6BA, HOXC6B, HOXC6 coding downstream 194507 1165179 ~ 1167258 (+)
G243432 NA non-coding upstream 72272 895395 ~ 898119 (+)
G243412 NA non-coding upstream 82798 880506 ~ 887593 (+)
G243406 NA non-coding upstream 100419 868914 ~ 869972 (+)
G243514 NA non-coding upstream 399483 570530 ~ 570908 (+)
G243509 NA non-coding upstream 407352 562812 ~ 563039 (+)
G243574 NA non-coding downstream 30456 1001128 ~ 1001330 (+)
G243584 NA non-coding downstream 116679 1087351 ~ 1091656 (+)
G243628 NA non-coding downstream 179187 1149859 ~ 1150069 (+)
G243605 NA non-coding downstream 190089 1160761 ~ 1164870 (+)
G243558 NA other upstream 12020 956063 ~ 958371 (+)
G243557 NA other upstream 15196 954843 ~ 955195 (+)
CI01000057_00417827_00418207 NA other upstream 549881 417700 ~ 418655 (+)
CI01000057_02395285_02396439 NA other downstream 1423926 2394598 ~ 2396561 (+)
G243975 NA other downstream 1605781 2576453 ~ 2576852 (+)
G243991 NA other downstream 1664565 2635237 ~ 2652560 (+)
G245231 NA other downstream 2116424 3087096 ~ 3292562 (+)
G245401 NA other downstream 2566897 3537569 ~ 3538442 (+)

Expression



Co-expression Network