G427844


Basic Information

Item Value
gene id G427844
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000304
NCBI id null
chromosome length 18613800
location 15714842 ~ 15715121 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU491274
TTCATATTTGCACTATATTTGAACCAATGACATAGCAACCAGCCTGTTTAACGACTTCCATGTCTTCCATATCTTCATAACAGCCGTTGTCCAATGCTGACCTTTAATAGTGATGTCCGTCTCTGGCACTGTTTCTTTTGCATGTAAATGTCTATCTGTCCAAATGCAATGGTTAAAGCCTGATTTAATCGGTGTGGACATCTGGTCACCCTGTGGTCACTACGTGCGTAGTCATCCTGGTTGTGAAGAAATTTGTCCTATTTGGCATGACCAAGTCTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU491274 True 280 lncRNA 0.42 1 15714842 15715121

Neighbor

gene id symbol gene type direction distance location
CI01000304_15500233_15509862 WNT11, WNT11.L, WNT11R coding upstream 204126 15500233 ~ 15510716 (+)
CI01000304_15483378_15486113 NA coding upstream 228456 15483378 ~ 15486386 (+)
CI01000304_15472687_15483327 NA coding upstream 231515 15472687 ~ 15483327 (+)
CI01000304_15467093_15471138 PRKRIRA coding upstream 243360 15467093 ~ 15471482 (+)
CI01000304_15462162_15465511 NA coding upstream 249331 15462162 ~ 15465511 (+)
CI01000304_15723867_15741978 NA coding downstream 8746 15723867 ~ 15742863 (+)
CI01000304_15776859_15777750 ZBTB21 coding downstream 61738 15776859 ~ 15777768 (+)
CI01000304_15779082_15779951 ZBTB21 coding downstream 63961 15779082 ~ 15780105 (+)
CI01000304_15785399_15786785 RAD51C coding downstream 70278 15785399 ~ 15787028 (+)
CI01000304_15817532_15846675 PPM1E coding downstream 100655 15814649 ~ 15846892 (+)
G427843 NA non-coding upstream 506 15713909 ~ 15714336 (+)
G427777 NA non-coding upstream 7445 15705318 ~ 15707397 (+)
G427776 NA non-coding upstream 11307 15622304 ~ 15703535 (+)
G427808 NA non-coding upstream 46972 15655415 ~ 15667870 (+)
G427811 NA non-coding upstream 55784 15658518 ~ 15659058 (+)
G427906 NA non-coding downstream 25137 15740258 ~ 15741104 (+)
G427915 NA non-coding downstream 94082 15809203 ~ 15812033 (+)
G427917 NA non-coding downstream 97982 15813103 ~ 15814423 (+)
G427904 NA non-coding downstream 125790 15840911 ~ 15851136 (+)
G426828 NA other upstream 764250 14948890 ~ 14950592 (+)
G426312 NA other upstream 1383956 14330048 ~ 14330886 (+)
CI01000304_13578347_13595075 NA other upstream 2135995 13578049 ~ 13595097 (+)
G425718 NA other upstream 3275756 12436554 ~ 12436605 (+)
CI01000304_10555326_10571933 NA other upstream 5159138 10555216 ~ 10572164 (+)
G427860 NA other downstream 170333 15885454 ~ 15889591 (+)
G428017 NA other downstream 368109 16083230 ~ 16083714 (+)
CI01000304_16505174_16506124 NA other downstream 789741 16504764 ~ 16513625 (+)
CI01000304_16761621_16764983 EXOSC8 other downstream 1040825 16761372 ~ 16765057 (+)
CI01000304_17009769_17023302 ZDHHC20, ZDHHC20A other downstream 1295609 17009769 ~ 17023882 (+)

Expression


Co-expression Network