AMCG00002871 (egr2,LOC107596614,LOC107596611,LOC107739063,LOC107745678,LOC107653961,LOC107593522)


Basic Information

Item Value
gene id AMCG00002871
gene name egr2,LOC107596614,LOC107596611,LOC107739063,LOC107745678,LOC107653961,LOC107593522
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030139.1
NCBI id CM030139.1
chromosome length 23121578
location 5231982 ~ 5233827 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00002871
ATGATGACAGCCAAAACTTTGGAGAAACCCCCCGCGACGCTCAGTGGTTTTGTGCACCCTCTTTCAGAAAACATCTACTCCGTGGACGAGATTGGCACAAGCCTGTCGACCTCGGTGGCAATCTTCCCTAATGCCGATTTAGGAGGACATTTCGACCACATTAGTGGAGTTTCAGGAGATGGCATGATCAATGGGGACATGAGCACGGACAAGCGCTCCCTCGACTTGTCCTACTCCAGCAGCTTCTCACAACCCTGCGCGCCCCGCAACCAGACTTTCACCTACATGGGCAAGTTCTCCATCGACTCTCAGTACCCAGGTGGCAACTGGAACCCGGAGAGTGTGATCAACATCGTCAGCGCCGGGATCCTGGGCATGACCCAGCCGCCCTCCTCGTCCTCGTCGCCGGCTTCTTCTTCAGTCTCCCCGAACCACTTCGCCAGCTCTCTGAGCTGCACCATGGCGCAGAACCAGCCCGACATGGATCACATCTACTCTCCACCTCCTCCTTATTCGGGCTGCGGGGAGGTCTACCAAGACCCGTCTGCCTTTCTTTCCACGTCTACCTGCCCCATTTCCTACCCTCCACCTATCTACTCCTCGCCCAAGCCGAACACAGACAGCGGTCTCTTTCCCATCATCCAAGACTATGCCAGCCTGTTTCAGCCTCCGTGCCAAAGAGACATCCAGTCGGTCCCTGACCGCAAGCCCTTCCCATGCCCACTAGACTCCATCAGAGTCCCCCCACCTCTCACCCCTCTCAACACTATACGGAACTTCACTTTAGGGGGGCCGACTACAGATGGACCCAGACTACCCACCGCTTACAGCCCCCAGAATTTACCCCTGAGACCTATCTTGCGGCCACGGAAATACCCCAACCGCCCCAGCAAGACCCCCGTTCATGAGCGGCCGTACCCCTGCCCGGCAGAGGGCTGCGACAGGAGGTTCTCCCGGTCCGACGAGCTGACCAGACACATCCGCATCCACACCGGGCACAAGCCCTTCCAGTGCCGCATCTGCATGAGGAATTTCAGCCGCAGCGACCACCTCACCACTCACATCCGCACCCACACCGGCGAGAAGCCCTTCGCCTGCGACTTCTGCGGCAGGAAATTTGCCCGCAGCGACGAGCGAAAGAGACACACGAAGATCCACCTCCGGCAGAAGGAGAGGAAATCGTCGTCCGCCGCGGCTCCCGGCAGCTCGGAGCGGTGCGCTGGCGCATCATCCGGGGCGGCGTGTCCTGCGGGCGGCGGGCAGCTCTCTGCGTGTCCGTCCAGGGCGGTGTAA

Function

symbol description
egr2 Enables DNA-binding transcription activator activity, RNA polymerase II-specific; RNA polymerase II cis-regulatory region sequence-specific DNA binding activity; and ubiquitin protein ligase binding activity. Involved in positive regulation of transcription by RNA polymerase II. Located in nucleoplasm. Implicated in Charcot-Marie-Tooth disease type 1D; Charcot-Marie-Tooth disease type 3; Charcot-Marie-Tooth disease type 4E; and motor peripheral neuropathy.

NR:

description
PREDICTED: early growth response protein 2b-like

GO:

id name namespace
GO:0048168 regulation of neuronal synaptic plasticity biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0071320 cellular response to cAMP biological_process
GO:0021575 hindbrain morphogenesis biological_process
GO:0071371 cellular response to gonadotropin stimulus biological_process
GO:0043066 negative regulation of apoptotic process biological_process
GO:0021654 rhombomere boundary formation biological_process
GO:0035914 skeletal muscle cell differentiation biological_process
GO:0048932 myelination of posterior lateral line nerve axons biological_process
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0046872 metal ion binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function

KEGG:

id description
K12496 EGR2; early growth response protein 2

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00002871 True 1293 mRNA 0.60 2 5231982 5233827

Neighbor

gene id symbol gene type direction distance location
AMCG00002868 jmjd1c,LOC108412835 coding upstream 44536 5153304 ~ 5187446 (+)
AMCG00002867 LOC108412396,LOC103044660,LOC104928862,LOC105891210 coding upstream 207399 5012179 ~ 5024583 (+)
AMCG00002866 exoc6,LOC107695547,LOC107654070 coding upstream 223237 4963957 ~ 5008745 (+)
AMCG00002864 NA coding upstream 279577 4952100 ~ 4952405 (+)
AMCG00002862 NA coding upstream 298777 4928430 ~ 4933205 (+)
AMCG00002872 NA coding downstream 43088 5276915 ~ 5285072 (+)
AMCG00002881 NA coding downstream 146786 5380613 ~ 5383693 (+)
AMCG00002882 NA coding downstream 150025 5383852 ~ 5386429 (+)
AMCG00002880 rhobtb1,LOC107654062,LOC106604002 coding downstream 184848 5418675 ~ 5435914 (+)
AMCG00002888 ank3,LOC107746453,LOC102308332 coding downstream 303663 5537490 ~ 5616805 (+)
G139170 NA non-coding upstream 163087 5067472 ~ 5068895 (+)
G139084 cpeb3 non-coding upstream 429738 4798613 ~ 4802244 (+)
G139044 NA non-coding upstream 519157 4626657 ~ 4712825 (+)
G139038 NA non-coding upstream 647815 4583865 ~ 4584167 (+)
G138946 NA non-coding upstream 1155194 4072281 ~ 4076788 (+)
G139205 NA non-coding downstream 5523 5239350 ~ 5239490 (+)
G139238 NA non-coding downstream 132608 5366435 ~ 5366683 (+)
G139263 cdk1,LOC106607826,LOC100136692 non-coding downstream 205950 5439777 ~ 5442279 (+)
G139351 NA non-coding downstream 584225 5818052 ~ 5819125 (+)
G139488 NA non-coding downstream 904294 6138121 ~ 6140671 (+)
G139176 NA other upstream 133238 5096731 ~ 5098744 (+)
G138941 NA other upstream 1202058 4029524 ~ 4029924 (+)
G138888 grid1,LOC106607602 other upstream 1635874 3428689 ~ 3596108 (+)
G138790 bub3,LOC106575478,LOC106577429,LOC107684575 other upstream 2115901 3107458 ~ 3116081 (+)
AMCG00002784 NA other upstream 2737388 2492086 ~ 2494594 (+)
G139492 NA other downstream 913921 6147748 ~ 6153120 (+)
AMCG00002939 ube2d1,ube2d1b,LOC105891213,LOC106607701,LOC103397267,LOC103397347,LOC105010549,LOC107717106,LOC107553913,LOC107733527 other downstream 1833028 7066855 ~ 7073538 (+)
G139720 LOC103376252,LOC104927182,LOC102078543,LOC101474510 other downstream 2142860 7376687 ~ 7379487 (+)
AMCG00002960 NA other downstream 2675425 7909252 ~ 7920908 (+)
G139784 NA other downstream 2689355 7923182 ~ 7926832 (+)

Expression


Co-expression Network