G17188


Basic Information

Item Value
gene id G17188
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 8514868 ~ 8515415 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU19292
TATCAGAGAGAGACCAGGATCATCAGCAGTCTTGAAGGTAAGGTCAAACCCACGATCTGCTAAACTGCGGAAGAAGATTGAATGGGTGTCTCTGATGTTGGGATTGTCCAACAAAACGAGAGTCTTTCCGTCTCCTAAAACCGCCTGCAACATTAACGCCAGGGATAAAGCAAACAGAGTGCTTTTGCTGAATCCACCAGACAATGTGGGAAACATTGTAGCACGCCGTCTTTTGCAGGTTAATGTTGCCACAGTCGCGGTGTCCCTCATTGACAAGCAACCCATCGCCATTTTCCTCCTTTGGACAACGTCAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU19292 True 315 lncRNA 0.46 2 8514868 8515415

Neighbor

gene id symbol gene type direction distance location
CI01000001_08444733_08450428 NA coding upstream 63944 8444733 ~ 8450924 (+)
CI01000001_08427984_08438912 NA coding upstream 75438 8427984 ~ 8439430 (+)
CI01000001_08365139_08380569 PTPN11B coding upstream 134174 8364229 ~ 8380694 (+)
CI01000001_08271059_08344201 AGRN coding upstream 170667 8271059 ~ 8344201 (+)
CI01000001_08248565_08260072 AGRN coding upstream 254767 8248565 ~ 8260101 (+)
CI01000001_08540376_08551579 CLCNK coding downstream 24488 8539903 ~ 8551725 (+)
CI01000001_08667814_08671039 NA coding downstream 152239 8667654 ~ 8671439 (+)
CI01000001_08714618_08721009 NA coding downstream 199203 8714618 ~ 8721182 (+)
CI01000001_08721737_08727450 KANSL2 coding downstream 206322 8721737 ~ 8727787 (+)
CI01000001_08748236_08757869 NCKAP5L coding downstream 232821 8748236 ~ 8758003 (+)
G17294 NA non-coding upstream 6387 8506767 ~ 8508481 (+)
G17292 NA non-coding upstream 21163 8493434 ~ 8493705 (+)
G17209 NA non-coding upstream 117956 8391063 ~ 8396912 (+)
G17215 NA non-coding upstream 231974 8279353 ~ 8282894 (+)
G17252 NA non-coding upstream 433126 8081512 ~ 8081742 (+)
G17295 NA non-coding downstream 842 8516257 ~ 8516801 (+)
G17194 NA non-coding downstream 15108 8530523 ~ 8533627 (+)
G17310 NA non-coding downstream 52716 8568131 ~ 8568362 (+)
G17311 NA non-coding downstream 52988 8568403 ~ 8568689 (+)
G17316 NA non-coding downstream 62054 8577469 ~ 8577809 (+)
G17234 NA other upstream 482385 8032124 ~ 8032483 (+)
CI01000001_07531945_07539781 NA other upstream 974282 7531541 ~ 7540586 (+)
G15995 NA other upstream 2799917 5711885 ~ 5714951 (+)
CI01000001_05279884_05287123 NA other upstream 3224912 5279837 ~ 5287698 (+)
G15794 NA other upstream 3450164 5061218 ~ 5064704 (+)
G17353 NA other downstream 700607 9216022 ~ 9228859 (+)
G17354 NA other downstream 719048 9234463 ~ 9240677 (+)
CI01000001_09435836_09436037 NA other downstream 902913 9435836 ~ 9436373 (+)
G18896 NA other downstream 1724485 10239900 ~ 10241492 (+)
G18873 NA other downstream 1741697 10223879 ~ 10260714 (+)

Expression


Co-expression Network