G22807


Basic Information

Item Value
gene id G22807
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000003
NCBI id null
chromosome length 2831192
location 563208 ~ 563430 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU25737
AAAGGACTTTATCCAACATACCTTGATCAAACTGGAGCAATCAGACCACATTTGGAGCTCATTCAAGTGGGCAGGACTGGACTTTGTTCTTAGTAGTTTATTCACTGTCATTATATGCAAAAAGTCACCACTTTAGGCTTAAATGTTGCTGTTTCTTGATAGCTTCTGTAATTGAATTCCTTAAAAAAACTATCCAATATCTGACCAGATGCTTTGACTTTTA

Function

NR:

description
PREDICTED: FRAS1-related extracellular matrix protein 2-like, partial

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU25737 True 223 lncRNA 0.36 1 563208 563430

Neighbor

gene id symbol gene type direction distance location
CI01000003_00473640_00508021 PEX5LB coding downstream 55187 473576 ~ 508021 (-)
CI01000003_00458786_00461307 NA coding downstream 101901 458468 ~ 461307 (-)
CI01000003_00418856_00424844 NA coding downstream 137239 418477 ~ 425969 (-)
CI01000003_00410927_00411601 SFT2D3 coding downstream 150700 410569 ~ 412508 (-)
CI01000003_00388122_00389931 DUSP28 coding downstream 173181 388122 ~ 390027 (-)
CI01000003_00640353_00641395 NA coding upstream 76512 639942 ~ 644060 (-)
CI01000003_00719773_00720087 NA coding upstream 156153 719583 ~ 720332 (-)
CI01000003_00806620_00830978 NA coding upstream 242921 806351 ~ 831623 (-)
CI01000003_01194276_01196374 BAMBIB coding upstream 629886 1193316 ~ 1197019 (-)
CI01000003_01200556_01220189 NA coding upstream 636622 1200052 ~ 1220189 (-)
G22798 NA non-coding downstream 32187 530806 ~ 531021 (-)
G22709 NA non-coding downstream 112092 450523 ~ 451116 (-)
G22781 NA non-coding downstream 123028 439122 ~ 440180 (-)
G22704 NA non-coding downstream 154897 406420 ~ 408311 (-)
G22767 NA non-coding downstream 185316 377605 ~ 377892 (-)
G22810 NA non-coding upstream 4568 567998 ~ 568221 (-)
G22698 NA non-coding upstream 7024 570454 ~ 573928 (-)
G22823 NA non-coding upstream 94006 657436 ~ 732257 (-)
G22821 NA non-coding upstream 153015 716445 ~ 718092 (-)
G22716 NA other downstream 493464 50512 ~ 69744 (-)

Expression


Co-expression Network