CI01000006_04255653_04256279 (CLDND)


Basic Information

Item Value
gene id CI01000006_04255653_04256279
gene name CLDND
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000006
NCBI id null
chromosome length 13024002
location 4255554 ~ 4256310 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000006_04255653_04256279.mRNA
ATAGACTGATTTTTGCACGCACAATAACGTAATGGCGTCTGCTGGACTTCAGATTTTGGCCACTGCCCTCGCGGTTATTGGCTGGTTGGGAGACATCATTATCTGCGCGCTCCCCATGTGGAAGGTGACGGCGTTTATTGGCACTAACATCGTGACCGCACAGATCTTCTGGGAAGGCCTTTGGATGAACTGCGTGCAGCAGAGCACAGGTCAGATGCAGTGCAAGGTCTACGACTCCATGCTGGCGCTACCGCAAGATCTCCAGGCCGCTCGTGCTCTTGTTATCATCTCCATCCTCGTGACCTTCCTGGGAGTTCTTCTGGCCGTCGCTGGAGGCAAGTGTACCAACTGCATTGACGACCGGGACGCCAAAGCCAAAGTAGGGGTCGCGGCCGGGGTGTTCTTCCTGGTGGGTGGTGTTCTCTGTCTGATCCCGGTCTGCTGGTGCGCTCACACAGTCATCCGAGACTTCTACAACCCCATCCTTTCTGAGGCTCAAAAGCGGGAGCTGGGAGCGTCGCTGTTCATCGGATGGGGCGCGTCTAGTCTGCTGCTTATCGGAGGCGCGCTTCTCTGTTGCCAGTGCCCGAAGAGTGAGGGTCGTGGTTATTCCGTGAAGTACTCCGCTCCGAGGTCTGCTCCAGGGGCCTATGTGTGAAACTCCGTCTTTATGAACTAATGACAAATTCTCCTGTTTGTAAAGGAAGAGATATGAACTTAACTTTCTGGTTTTTCATTACTATTTTAATGTAATAAA

Function

symbol description
cldnd Predicted to enable identical protein binding activity. Predicted to be involved in bicellular tight junction assembly and calcium-independent cell-cell adhesion via plasma membrane cell-adhesion molecules. Predicted to be located in cell junction and membrane. Predicted to be integral component of membrane. Predicted to be active in bicellular tight junction and plasma membrane. Is expressed in gill; gonad; integument; kidney; and muscle. Human ortholog(s) of this gene implicated in ovarian cancer and pancreatic cancer. Orthologous to several human genes including CLDN4 (claudin 4).

NR:

description
Claudin-4

GO:

id name namespace
GO:0016338 calcium-independent cell-cell adhesion via plasma membrane cell-adhesion molecules biological_process

KEGG:

id description
K06087 CLDN; claudin

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000006_04255653_04256279.mRNA True 757 mRNA 0.53 1 4255554 4256310

Neighbor

gene id symbol gene type direction distance location
CI01000006_04251946_04252512 NA coding downstream 3042 4251699 ~ 4252512 (-)
CI01000006_04247383_04247973 CLDN28B coding downstream 7581 4247316 ~ 4247973 (-)
CI01000006_04244321_04245262 NA coding downstream 8340 4243894 ~ 4247214 (-)
CI01000006_04232222_04238240 NF2B, NF2 coding downstream 17314 4231908 ~ 4238240 (-)
CI01000006_04154152_04182430 CALN2, CALN1 coding downstream 73124 4154095 ~ 4182430 (-)
CI01000006_04259401_04260036 NA coding upstream 2943 4259253 ~ 4260071 (-)
CI01000006_04262648_04264650 CLDNB coding upstream 5893 4262203 ~ 4264683 (-)
CI01000006_04295568_04304414 NA coding upstream 39047 4295357 ~ 4304868 (-)
CI01000006_04313539_04316100 NA coding upstream 57096 4313406 ~ 4316100 (-)
CI01000006_04322555_04322827 NA coding upstream 66158 4322468 ~ 4324361 (-)
G43525 NA non-coding downstream 52297 4203051 ~ 4203257 (-)
G43522 NA non-coding downstream 73270 4182080 ~ 4182284 (-)
G43520 NA non-coding downstream 76210 4179053 ~ 4179344 (-)
G43516 NA non-coding downstream 88976 4166315 ~ 4166578 (-)
G43539 NA non-coding upstream 8654 4264964 ~ 4273914 (-)
G43546 NA non-coding upstream 110774 4367084 ~ 4367884 (-)
G43573 NA non-coding upstream 112090 4368400 ~ 4368617 (-)
G43578 NA non-coding upstream 126987 4383297 ~ 4384353 (-)
G43582 NA non-coding upstream 129970 4386280 ~ 4386480 (-)
G43102 NA other downstream 1321570 2908451 ~ 2933984 (-)
CI01000006_02624725_02626124 COX8A other downstream 1629368 2624436 ~ 2626776 (-)
G42934 NA other downstream 1673348 2523776 ~ 2582206 (-)
CI01000006_02285649_02294759 NA other downstream 1960556 2284994 ~ 2296494 (-)
G42667 NA other downstream 2364798 1888988 ~ 1890756 (-)
G43549 NA other upstream 96200 4352510 ~ 4355428 (-)
CI01000006_04560607_04560993 NA other upstream 303199 4559509 ~ 4562068 (-)
CI01000006_06974359_06976736 NA other upstream 2716914 6973224 ~ 6976872 (-)
CI01000006_07500281_07507754 NA other upstream 3246835 7500246 ~ 7507976 (-)
CI01000006_10453630_10483241 NA other upstream 6226546 10453613 ~ 10484006 (-)

Expression


Co-expression Network