G51272


Basic Information

Item Value
gene id G51272
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 2401033 ~ 2401367 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU58426
CTGCAGTGGTTCAACCTTAATGTTATGAAGCGACAAAACAAAACAAAACAAAAATAACAACTTTATTCAACAATCTCTTCCGCTTCCGTGTTTACGTCTGAATGCCGGCTCAGTATTGGCCAACGTTGATCACGTGAGCAGCACGATGCATGCGTGTGATGCTGACGCAGGAGCCGGCCAATAATGAGTCAGAGTTCTGATGTAGAACCTGGAAGTGCTAGACATATGAGAATGACACAGAAGAGAAGATATTGTTGAATAAAGTCGTTATTGTTTTTTGTTTTTGCGCACAAAAAGTATTCTCGTCACTTCATAAAATTAAGGTTGAACCACTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU58426 True 335 lncRNA 0.43 1 2401033 2401367

Neighbor

gene id symbol gene type direction distance location
CI01000009_02398010_02399639 NA coding upstream 1281 2396065 ~ 2399752 (+)
CI01000009_02375481_02385887 NA coding upstream 15032 2375076 ~ 2386001 (+)
CI01000009_02284485_02285584 NA coding upstream 114904 2284485 ~ 2286129 (+)
CI01000009_02233367_02235148 RABL3 coding upstream 165240 2233367 ~ 2235793 (+)
CI01000009_02028234_02100154 PLCL1 coding upstream 300879 2028234 ~ 2100154 (+)
CI01000009_02426085_02433745 CNGA4 coding downstream 24208 2425575 ~ 2433795 (+)
CI01000009_02449805_02450173 NHLH2 coding downstream 46630 2447997 ~ 2450356 (+)
CI01000009_02479541_02488142 VANGL1 coding downstream 78174 2479541 ~ 2488759 (+)
CI01000009_02499173_02519062 DOPEY2 coding downstream 97602 2498969 ~ 2519155 (+)
CI01000009_02572388_02587828 USP9, USP9X coding downstream 171021 2572388 ~ 2588051 (+)
G51270 NA non-coding upstream 139 2399778 ~ 2400894 (+)
G51358 NA non-coding upstream 32619 2368182 ~ 2368414 (+)
G51265 NA non-coding upstream 37862 2242709 ~ 2363171 (+)
G51347 NA non-coding upstream 77176 2323267 ~ 2323857 (+)
G51318 NA non-coding upstream 158701 2242125 ~ 2242332 (+)
G51354 NA non-coding downstream 14333 2415700 ~ 2425283 (+)
G51368 NA non-coding downstream 26755 2428122 ~ 2428322 (+)
G51384 NA non-coding downstream 153372 2554739 ~ 2621187 (+)
G51394 NA non-coding downstream 230410 2631777 ~ 2633862 (+)
G51470 NA non-coding downstream 421595 2822962 ~ 2823706 (+)
G51274 NA other upstream 50547 2255099 ~ 2350486 (+)
CI01000009_01897343_01919208 PIKFYVE other upstream 499607 1897343 ~ 1919516 (+)
G51122 NA other upstream 719067 1680146 ~ 1681966 (+)
CI01000009_01431700_01434463 NA other upstream 962678 1429873 ~ 1435328 (+)
G50920 NA other upstream 1630800 769841 ~ 770233 (+)
G51529 NA other downstream 660666 3062033 ~ 3062587 (+)
CI01000009_03202999_03207060 MPC2, MPC2.S other downstream 801405 3202207 ~ 3208984 (+)
G53388 NA other downstream 3120875 5522242 ~ 5540638 (+)
CI01000009_05931829_05943829 KCNH3 other downstream 3458935 5931718 ~ 5943899 (+)
G53651 NA other downstream 3844197 6245564 ~ 6248392 (+)

Expression


Co-expression Network