G51318


Basic Information

Item Value
gene id G51318
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 2242125 ~ 2242332 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU58472
TATGACCATAATATGAGAAATTTTATAAGTTATTTTTGTTAGGCAGCATGCTGCTGAATGCATGGACGTAATATACTGCCGCATATTTAGTTTTTACCCACCTGTTTACGTCCACTTAAGCCATAACCGACTGTATTCACGCGAGATACTCCACACGATGGACATTTTGACATCTGTGTGTGCGCGTGTATTTGACTATTCAGGGGCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU58472 True 208 lncRNA 0.40 1 2242125 2242332

Neighbor

gene id symbol gene type direction distance location
CI01000009_02233367_02235148 RABL3 coding upstream 6332 2233367 ~ 2235793 (+)
CI01000009_02028234_02100154 PLCL1 coding upstream 141971 2028234 ~ 2100154 (+)
CI01000009_01993176_01999494 MOBL3, MOB4.S, HSPE1, MOB3, HSPE1-MOB4, MOB4 coding upstream 242252 1993176 ~ 1999873 (+)
CI01000009_01990700_01991267 HSP10, HSPE1 coding upstream 250738 1990700 ~ 1991387 (+)
CI01000009_01966898_01976924 COQ10B coding upstream 264391 1966898 ~ 1977734 (+)
CI01000009_02284485_02285584 NA coding downstream 42153 2284485 ~ 2286129 (+)
CI01000009_02375481_02385887 NA coding downstream 132744 2375076 ~ 2386001 (+)
CI01000009_02398010_02399639 NA coding downstream 153733 2396065 ~ 2399752 (+)
CI01000009_02426085_02433745 CNGA4 coding downstream 183243 2425575 ~ 2433795 (+)
CI01000009_02449805_02450173 NHLH2 coding downstream 205665 2447997 ~ 2450356 (+)
G51267 NA non-coding upstream 13021 2227654 ~ 2229104 (+)
G51294 NA non-coding upstream 14666 2226894 ~ 2227459 (+)
G51311 NA non-coding upstream 30813 2211083 ~ 2211312 (+)
G51261 NA non-coding upstream 89738 2151887 ~ 2152387 (+)
G51238 NA non-coding upstream 125404 2099278 ~ 2116721 (+)
G51265 NA non-coding downstream 377 2242709 ~ 2363171 (+)
G51347 NA non-coding downstream 80935 2323267 ~ 2323857 (+)
G51358 NA non-coding downstream 125850 2368182 ~ 2368414 (+)
G51270 NA non-coding downstream 157446 2399778 ~ 2400894 (+)
G51272 NA non-coding downstream 158701 2401033 ~ 2401367 (+)
CI01000009_01897343_01919208 PIKFYVE other upstream 340699 1897343 ~ 1919516 (+)
G51122 NA other upstream 560159 1680146 ~ 1681966 (+)
CI01000009_01431700_01434463 NA other upstream 803770 1429873 ~ 1435328 (+)
G50920 NA other upstream 1471892 769841 ~ 770233 (+)
CI01000009_00094836_00095813 NA other upstream 2146338 94371 ~ 97230 (+)
G51274 NA other downstream 12767 2255099 ~ 2350486 (+)
G51529 NA other downstream 819701 3062033 ~ 3062587 (+)
CI01000009_03202999_03207060 MPC2, MPC2.S other downstream 960440 3202207 ~ 3208984 (+)
G53388 NA other downstream 3279910 5522242 ~ 5540638 (+)
CI01000009_05931829_05943829 KCNH3 other downstream 3617970 5931718 ~ 5943899 (+)

Expression


Co-expression Network