CI01000009_01990700_01991267 (HSP10, HSPE1)


Basic Information

Item Value
gene id CI01000009_01990700_01991267
gene name HSP10, HSPE1
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000009
NCBI id null
chromosome length 16003125
location 1990700 ~ 1991387 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000009_01990700_01991267.mRNA
CAGGCTTTCCGGAAATTCCTTCCCATGTTCGACCGTGTGTTGGTGGAGCGGCTTGCTGCAGAGACCGTTTCAAGAGGAGGCATCATGATTCCAGAAAAGTCTCAAGCCAAAGTGCAACAGGCTACAGTGGTAGCAGTAGGTCCAGGATCCACCAACAAGGATGGGAAAGTAACACCTGTCTGTGTCAAAGTTGGGGATAAAGTTTTGCTGCCTGAGTACGGAGGAACTAAAGTTGTACTTGAGGATAAGGATTACTTCCTTTTCCGGGATGGAGATATTCTTGGCAAATATGTAGAATGAAGTCTGCTTGTTCAACCATCTGCGTCATTCTGGAGTTCATAGAAATAATGGCTGTTCCATGTTTGTTTTCTTTTTTCTATGTCATTTGATTGTAAATAAGTATGATCATGTTTTGTTCAA

Function

symbol description
hspe1 Predicted to enable chaperone binding activity; metal ion binding activity; and unfolded protein binding activity. Predicted to be involved in chaperone cofactor-dependent protein refolding. Predicted to act upstream of or within protein folding. Predicted to be active in mitochondrial matrix. Is expressed in several structures, including alar plate midbrain region; digestive system; midbrain; pectoral fin; and segmental plate. Orthologous to human HSPE1 (heat shock protein family E (Hsp10) member 1).
hsp10 Enables chaperone binding activity and unfolded protein binding activity. Involved in chaperone-mediated protein complex assembly; protein import into mitochondrial intermembrane space; and protein refolding. Located in mitochondrial matrix. Orthologous to human HSPE1 (heat shock protein family E (Hsp10) member 1).

GO:

id name namespace
GO:0005737 cytoplasm cellular_component

KEGG:

id description
K04078 groES, HSPE1; chaperonin GroES

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000009_01990700_01991267.mRNA True 420 mRNA 0.43 3 1990700 1991387

Neighbor

gene id symbol gene type direction distance location
CI01000009_01966898_01976924 COQ10B coding upstream 12966 1966898 ~ 1977734 (+)
CI01000009_01897343_01919208 PIKFYVE coding upstream 71184 1897343 ~ 1919516 (+)
CI01000009_01892219_01893628 NA coding upstream 96946 1892219 ~ 1893754 (+)
CI01000009_01733394_01738937 ITGBL1 coding upstream 251232 1731294 ~ 1739468 (+)
CI01000009_01692563_01725364 ITGBL1 coding upstream 265336 1692563 ~ 1725364 (+)
CI01000009_01993176_01999494 MOBL3, MOB4.S, HSPE1, MOB3, HSPE1-MOB4, MOB4 coding downstream 1789 1993176 ~ 1999873 (+)
CI01000009_02028234_02100154 PLCL1 coding downstream 36847 2028234 ~ 2100154 (+)
CI01000009_02233367_02235148 RABL3 coding downstream 241980 2233367 ~ 2235793 (+)
CI01000009_02284485_02285584 NA coding downstream 293098 2284485 ~ 2286129 (+)
CI01000009_02375481_02385887 NA coding downstream 383689 2375076 ~ 2386001 (+)
G51175 NA non-coding upstream 29983 1959260 ~ 1960717 (+)
G51216 NA non-coding upstream 37337 1953141 ~ 1953363 (+)
G51183 NA non-coding upstream 64981 1880934 ~ 1925719 (+)
G51198 NA non-coding upstream 109790 1880711 ~ 1880910 (+)
G51197 NA non-coding upstream 110343 1880111 ~ 1880357 (+)
G51228 NA non-coding downstream 32722 2024109 ~ 2024459 (+)
G51185 NA non-coding downstream 47082 2038469 ~ 2045644 (+)
G51238 NA non-coding downstream 107891 2099278 ~ 2116721 (+)
G51261 NA non-coding downstream 160500 2151887 ~ 2152387 (+)
G51311 NA non-coding downstream 219696 2211083 ~ 2211312 (+)
G51122 NA other upstream 308734 1680146 ~ 1681966 (+)
CI01000009_01431700_01434463 NA other upstream 552345 1429873 ~ 1435328 (+)
G50920 NA other upstream 1220467 769841 ~ 770233 (+)
CI01000009_00094836_00095813 NA other upstream 1894913 94371 ~ 97230 (+)
G51274 NA other downstream 263712 2255099 ~ 2350486 (+)
G51529 NA other downstream 1070646 3062033 ~ 3062587 (+)
CI01000009_03202999_03207060 MPC2, MPC2.S other downstream 1211385 3202207 ~ 3208984 (+)
G53388 NA other downstream 3530855 5522242 ~ 5540638 (+)
CI01000009_05931829_05943829 KCNH3 other downstream 3868915 5931718 ~ 5943899 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location