G85676



Basic Information


Item Value
gene id G85676
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000013
NCBI id null
chromosome length 12551977
location 11706125 ~ 11706464 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU97518
TGCTTATGTTTTCCTGGTGTGTGTAAATGTTCATATCATGTGGATTTGTGTCAAGGATGTGTGTGTTATTAGCTCTATCCTCCTGCACTGCAATAGAGACAGCTTCTTCTTTCTGTTGAGTCGAGGTCAATTCCTGAATGTGATTCTCTCCATGGGCTGGCTTGCTCCAGGCCAGTGTGATCAAAGAGTTTTGTTTCTCCACTGAAATCTCCTCAAAGTCTCCTTTGCTCTTAATGTCTCCCTCTTCACTTTTTC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU97518 True 255 lncRNA 0.43 2 11706125 11706464

Neighbor


gene id symbol gene type direction distance location
CI01000013_11634008_11643242 NA coding downstream 62883 11633342 ~ 11643242 (-)
CI01000013_11596784_11604320 NA coding downstream 101260 11596688 ~ 11604865 (-)
CI01000013_11566351_11566887 NA coding downstream 139238 11566125 ~ 11566887 (-)
CI01000013_11516609_11563528 VWF coding downstream 142597 11516291 ~ 11563528 (-)
CI01000013_11480488_11512738 NA coding downstream 193387 11480488 ~ 11512738 (-)
CI01000013_11776137_11791017 LMF2A coding upstream 69410 11775874 ~ 11791017 (-)
CI01000013_11794495_11842660 C2CD5 coding upstream 87618 11794082 ~ 11842675 (-)
CI01000013_11860175_11889068 NA coding upstream 153438 11859902 ~ 11890116 (-)
CI01000013_11893589_11902743 FKBP4 coding upstream 186826 11893290 ~ 11902743 (-)
CI01000013_11920663_11935058 NA coding upstream 213660 11920124 ~ 11935058 (-)
G85661 NA non-coding downstream 23092 11681183 ~ 11683033 (-)
G85632 NA non-coding downstream 110824 11593301 ~ 11595301 (-)
G85620 NA non-coding downstream 140619 11565132 ~ 11565506 (-)
G85585 NA non-coding downstream 269972 11435862 ~ 11436153 (-)
G85570 NA non-coding downstream 284834 11417265 ~ 11421291 (-)
G85454 NA non-coding upstream 64285 11770749 ~ 11775434 (-)
G85481 NA non-coding upstream 141803 11848267 ~ 11851199 (-)
G85712 NA non-coding upstream 240906 11947370 ~ 11954012 (-)
G85715 NA non-coding upstream 247607 11954071 ~ 11955117 (-)
G85718 NA non-coding upstream 254974 11961438 ~ 11966326 (-)
G85401 NA other downstream 670659 11035032 ~ 11035466 (-)
G85188 NA other downstream 1110788 10592204 ~ 10595337 (-)
CI01000013_10564288_10569141 NA other downstream 1133685 10563459 ~ 10569290 (-)
G85170 NA other downstream 1225425 10479861 ~ 10480700 (-)

Expression



Co-expression Network