G166847



Basic Information


Item Value
gene id G166847
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000032
NCBI id null
chromosome length 4185905
location 3078641 ~ 3079096 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU189541
AAAAAAGTTGGGACACTGTACAAATTGTGAATAAAAAAGGAATGCAATGATGTGGAAGTTTCAAATTTCAATATTTTATTCAGAATACAACATAGATGACATATCAAATGTTTAAACTGAGAAAATGTATCATTTTAAGGGAAAAATAAGTTGATTTTAAATTTCATGGCATCAACACATCTCAAAAAAGTTGGGACAAGGCCATGTTTACCACTGTGTGGCATCCCCTCTTCTTTTTATAATAATCTGCAAACGTCTGGGGACTGAGGAGACAAGTTGCTCAAGTTTAGGAATAGGAATGTTGTCCCATTCTTGTCTAATACAGGCTTCTAGTTGCTCAACTGTCTTAGGTCTTCTTTGTCGCATCTTCCTCTTTATGATGCGCCAAATGTTTTCTATGGGTGAAAGATCTGGACTGCAGCCTGGCCATTTCAGTACCCGGATCCTTCTTCTACG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU189541 True 456 lncRNA 0.37 1 3078641 3079096

Neighbor


gene id symbol gene type direction distance location
CI01000032_03046961_03053202 RRAGA.L, RRAGB, RRAGA, MGC78980 coding upstream 24715 3046961 ~ 3053926 (+)
CI01000032_02857743_02864895 SYBL1, VAMP7 coding upstream 213666 2856913 ~ 2864975 (+)
CI01000032_02827399_02829641 NA coding upstream 248923 2827399 ~ 2829718 (+)
CI01000032_02773889_02774396 NA coding upstream 304140 2773889 ~ 2774501 (+)
CI01000032_02768103_02768518 NA coding upstream 310123 2767994 ~ 2768518 (+)
CI01000032_03083089_03083664 NA coding downstream 2887 3081983 ~ 3084146 (+)
CI01000032_03142737_03156736 NA coding downstream 62646 3141742 ~ 3158789 (+)
CI01000032_03168377_03169554 NA coding downstream 89185 3168281 ~ 3169747 (+)
CI01000032_03210864_03212974 TMEM129 coding downstream 131768 3210864 ~ 3214164 (+)
CI01000032_03323107_03325296 NA coding downstream 244011 3323107 ~ 3325637 (+)
G166842 NA non-coding upstream 13647 3064780 ~ 3064994 (+)
G166841 NA non-coding upstream 13958 3064241 ~ 3064683 (+)
G166836 NA non-coding upstream 42164 3036167 ~ 3036477 (+)
G166835 NA non-coding upstream 43141 3035237 ~ 3035500 (+)
G166775 NA non-coding upstream 114636 2963784 ~ 2964005 (+)
G166853 NA non-coding downstream 13013 3092109 ~ 3092325 (+)
G166860 NA non-coding downstream 27651 3106747 ~ 3107151 (+)
G166861 NA non-coding downstream 31046 3110142 ~ 3110345 (+)
G166862 NA non-coding downstream 31810 3110906 ~ 3527585 (+)
G166857 NA non-coding downstream 114938 3194034 ~ 3196104 (+)
G166765 NA other upstream 121428 2956788 ~ 2957213 (+)
G166734 NA other upstream 228957 2835314 ~ 2849684 (+)
CI01000032_01698448_01701006 NA other upstream 1377353 1698448 ~ 1701288 (+)
G165570 NA other upstream 1721074 1349578 ~ 1357567 (+)

Expression



Co-expression Network