G170658 (tmtops2b,LOC108431481,LOC107559924,LOC107748531,LOC107738308)


Basic Information

Item Value
gene id G170658
gene name tmtops2b,LOC108431481,LOC107559924,LOC107748531,LOC107738308
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035915.1
NCBI id CM008318.1
chromosome length 35429340
location 28178974 ~ 28179208 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU230999
CTGTTTGTTCATAAGAATGTAAATAACTGGGTTGATGACTGTGCTGCTCTTGGCTAGGAGAGAGGGCACCACGCTCGCCACAGGTGTGATGATTCCTGGCCGACCAAACGTGGCCATTATGGCCACCACGCTGTACGGCGTCCAGCACAGCAGGTAACACACCACTGTAGTGATCACCATAAACAACACGTGATACTCCCTCCTCCGAGCTGCAGACTTGCGAATCTTTCCTACC

Function

symbol description
tmtops2b Enables photoreceptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway; cellular response to light stimulus; and phototransduction. Predicted to act upstream of or within protein-chromophore linkage; signal transduction; and visual perception. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in photoreceptor outer segment. Predicted to be integral component of plasma membrane. Is expressed in several structures, including brain; eye; gut; heart; and testis.

NR:

description
PREDICTED: vertebrate ancient opsin-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU230999 True 235 lncRNA 0.52 1 28178974 28179208

Neighbor

gene id symbol gene type direction distance location
uxs1 uxs1,LOC107688726,LOC107676432,LOC107551074 coding downstream 25327 28097459 ~ 28153647 (-)
LOC103028198 LOC103028198 coding downstream 284087 27889747 ~ 27894887 (-)
LOC103030840 spryd7,LOC108430519,LOC107600395,LOC108266652 coding downstream 335421 27836324 ~ 27843553 (-)
LOC103030092 kpna3,LOC108430517,LOC103046682,LOC107676880 coding downstream 343501 27824339 ~ 27835473 (-)
gtpbp8 gtpbp8 coding downstream 355611 27815809 ~ 27823363 (-)
st6gal2 st6gal2 coding upstream 1796 28181004 ~ 28249266 (-)
pdzk1 NA coding upstream 133291 28312499 ~ 28327425 (-)
LOC103034135 irs2 coding upstream 882710 29061918 ~ 29079952 (-)
col4a1 col4a1,col4a5 coding upstream 990478 29169686 ~ 29235749 (-)
rab20 NA coding upstream 1163089 29342297 ~ 29351215 (-)
G170657 tmtops2b,LOC108431481,LOC107716802,LOC107602912,LOC108266815,LOC107096900,LOC107688724,LOC107551048 non-coding downstream 3320 28175335 ~ 28175654 (-)
G170611 rnaseh2b,LOC107600410 non-coding downstream 289297 27882680 ~ 27889677 (-)
G170603 NA non-coding downstream 316422 27862156 ~ 27862552 (-)
G170582 trim13 non-coding downstream 327783 27845972 ~ 27851191 (-)
LOC111194936 NA non-coding downstream 558187 27617687 ~ 27620787 (-)
G170661 NA non-coding upstream 9280 28188488 ~ 28191125 (-)
G170685 NA non-coding upstream 248269 28427477 ~ 28427687 (-)
G170858 NA non-coding upstream 614064 28793272 ~ 28793875 (-)
G170875 NA non-coding upstream 777252 28956460 ~ 28959010 (-)
G170881 NA non-coding upstream 839946 29019154 ~ 29019560 (-)
LOC111194963 NA other downstream 276075 27900191 ~ 27902899 (-)
LOC103029246 LOC108430494,LOC108266255,LOC107551943,LOC107663912,LOC107733654,LOC107738526 other downstream 1926708 26226457 ~ 26252266 (-)
LOC103030841 uggt2,LOC108430493,LOC108266228,LOC107600415,LOC107663813,LOC107555197 other downstream 2273358 25798510 ~ 25905616 (-)
LOC111194864 NA other downstream 2669558 25501940 ~ 25509416 (-)
G169980 arglu1a,arglu1,LOC107555859,LOC108438027,LOC107673121,LOC107675355 other downstream 3826066 24307650 ~ 24352908 (-)
G170854 NA other upstream 506842 28686050 ~ 28687679 (-)
gabpa gabpa,LOC107695462,LOC107756759,LOC107595806 other upstream 3716624 31895832 ~ 31904168 (-)
ndp ndp,LOC107748154,LOC107756747,LOC107695497 other upstream 4579299 32758507 ~ 32776018 (-)
G171553 NA other upstream 4994845 33174053 ~ 33176284 (-)
LOC103028031 LOC108426040 other upstream 5035114 33214322 ~ 33235878 (-)

Expression


Co-expression Network