RNA id: TCONS_00025313


Basic Information

Item Value
RNA id TCONS_00025313
length 573
RNA type mRNA
GC content 0.50
exon number 4
gene id XLOC_012667
representative False

Chromosome Information

Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 14342326 ~ 14421236 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGAGCAGGGGTCAGAGGAGAACATGGAGAGCTCATGGACACTGCTGTCCTGGATGGCTTCTGGCGTGATGGTTTTTGGGGGCGCAGTGCCGTATGTTCCGCAGTACCAGGAGATCCAGAGGACCAGCAACGCTGAGGGATTCTCAACAAGAGTCTGTCTGGTGCTGCTCATCGCAAATATACTGCGCATTTTCTTCTGGATAGGCAAACAATTTGAGCTGCCTTTGCTTCTACAGAGTGTGGTGATGATTCTCACCATGTTGGCGATGCTGCATTTGTGCTGTTCAATCCAGAGCAGCAACCGTGTCAGTACCAAACAGCACCACATCACAGATTTGGACCTTCGGTATTTTTGGAGCTGGAGTTCTTTTGAGGATTATCTGATGTTTTGCTTCGCCTTTACACTGCTGTGCGCTTTCATAACGTTCCTCTTTTTGGATTGGCTGCTGTTTGTGGAGGCCCTGGGCTCTCAGGCTGTAATGTTTGAAGCCATGTTGGGTCTTCCTCAGCTGCTGCAGAACTACAACAACCGCTCCACTCGAGGGATGAGAGCCAGAAAGTATTTAGAGTAA

Function

GO:

id name namespace
GO:0042147 retrograde transport, endosome to Golgi biological_process
GO:0045332 phospholipid translocation biological_process
GO:0005768 endosome cellular_component
GO:0005802 trans-Golgi network cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-050419-100 Predicted to be involved in phospholipid translocation and retrograde transport, endosome to Golgi. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in endosome and trans-Golgi network. Orthologous to human SLC66A2 (solute carrier family 66 member 2).

Ensembl:

ensembl_id ENSDART00000181013

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00027070 lncRNA upstream 102867 14234369 ~ 14239459 (+) True XLOC_012665
TCONS_00027069 lncRNA upstream 827018 13494245 ~ 13515308 (+) True XLOC_012662
TCONS_00026876 lncRNA upstream 827173 13494240 ~ 13515153 (+) False XLOC_012662
TCONS_00027068 lncRNA upstream 1182572 13133657 ~ 13159754 (+) True XLOC_012654
TCONS_00026875 lncRNA upstream 1400306 12941800 ~ 12942020 (+) True XLOC_012652
TCONS_00025327 lncRNA downstream 244887 14645724 ~ 14647889 (+) False XLOC_012672
TCONS_00025328 lncRNA downstream 247083 14647920 ~ 14649295 (+) False XLOC_012672
TCONS_00025329 lncRNA downstream 251959 14652796 ~ 14655181 (+) True XLOC_012672
TCONS_00025332 lncRNA downstream 292937 14693774 ~ 14697233 (+) True XLOC_012674
TCONS_00026877 lncRNA downstream 1031869 15432706 ~ 15436113 (+) False XLOC_012680
TCONS_00025312 mRNA upstream 10266 14329231 ~ 14332060 (+) True XLOC_012666
TCONS_00025311 mRNA upstream 10463 14307059 ~ 14331863 (+) False XLOC_012666
TCONS_00025310 mRNA upstream 12887 14277003 ~ 14329439 (+) False XLOC_012666
TCONS_00025308 mRNA upstream 208291 13837746 ~ 14134035 (+) True XLOC_012663
TCONS_00025307 mRNA upstream 209606 13792490 ~ 14132720 (+) False XLOC_012663
TCONS_00025315 mRNA downstream 76903 14477740 ~ 14530633 (+) False XLOC_012668
TCONS_00025316 mRNA downstream 128168 14529005 ~ 14530633 (+) True XLOC_012668
TCONS_00025317 mRNA downstream 163248 14564085 ~ 14579787 (+) False XLOC_012669
TCONS_00025318 mRNA downstream 163249 14564086 ~ 14569649 (+) False XLOC_012669
TCONS_00025319 mRNA downstream 163249 14564086 ~ 14569658 (+) True XLOC_012669
TCONS_00025309 other upstream 393402 13948810 ~ 13948924 (+) True XLOC_012664
TCONS_00025284 other upstream 2511306 11830905 ~ 11831020 (+) True XLOC_012642
TCONS_00025282 other upstream 2884996 11457213 ~ 11457330 (+) True XLOC_012639
TCONS_00025273 other upstream 3600163 10742049 ~ 10742163 (+) True XLOC_012635
TCONS_00025271 other upstream 3671588 10670661 ~ 10670738 (+) True XLOC_012633
TCONS_00025324 other downstream 242034 14642871 ~ 14649295 (+) False XLOC_012672
TCONS_00025333 other downstream 588242 14989079 ~ 14996705 (+) True XLOC_012675
TCONS_00025343 other downstream 1311592 15712429 ~ 15712545 (+) True XLOC_012689
TCONS_00025358 other downstream 1732847 16133684 ~ 16140348 (+) False XLOC_012697
TCONS_00025367 other downstream 2315114 16715951 ~ 16719190 (+) False XLOC_012703

Expression Profile

//