RNA id: TCONS_00025314


Basic Information

Item Value
RNA id TCONS_00025314
length 726
RNA type mRNA
GC content 0.50
exon number 4
gene id XLOC_012667
representative True

Chromosome Information

Item Value
chromosome id NC_007129.7
NCBI id CM002902.2
chromosome length 51023478
location 14342326 ~ 14421236 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGAGCAGGGGTCAGAGGAGAACATGGAGAGCTCATGGACACTGCTGTCCTGGATGGCTTCTGGCGTGATGGTTTTTGGGGGCGCAGTGCCGTATGTTCCGCAGTACCAGGAGATCCAGAGGACCAGCAACGCTGAGGGATTCTCAACAAGAGTCTGTCTGGTGCTGCTCATCGCAAATATACTGCGCATTTTCTTCTGGATAGGCAAACAATTTGAGCTGCCTTTGCTTCTACAGAGTGTGGTGATGATTCTCACCATGTTGGCGATGCTGCATTTGTGCTGTTCAATCCAGAGCAGCAACCGTGTCAGTACCAAACAGCACCACATCACAGATTTGGACCTTCGGTATTTTTGGAGCTGGAGTTCTTTTGAGGATTATCTGATGTTTTGCTTCGCCTTTACACTGCTGTGCGCTTTCATAACGTTCCTCTTTTTGGATTGGCTGCTGTTTGTGGAGGCCCTGGGCTCTCAGGCTGTAATGTTTGAAGCCATGTTGGGTCTTCCTCAGCTGCTGCAGAACTACAACAACCGCTCCACTCGAGGGATGAGCGTAAAGATGGTGCTTTTATGGACCGCCGGTGACGTCTTTAAGACCACATATTTTGTGATCAATGAAAGCCCTGCCCAGTTCCTGGTTTGTGGTGCGGTGCAGATTTTAATTGACATTGCTATCCTGCTCCAGGTGGGCTACTATGGCCAGGACTCCAGAATCAAACTTGGCTAA

Function

GO:

id name namespace
GO:0042147 retrograde transport, endosome to Golgi biological_process
GO:0045332 phospholipid translocation biological_process
GO:0005768 endosome cellular_component
GO:0005802 trans-Golgi network cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-050419-100 Predicted to be involved in phospholipid translocation and retrograde transport, endosome to Golgi. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in endosome and trans-Golgi network. Orthologous to human SLC66A2 (solute carrier family 66 member 2).

Ensembl:

ensembl_id ENSDART00000138372

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00027070 lncRNA upstream 102867 14234369 ~ 14239459 (+) True XLOC_012665
TCONS_00027069 lncRNA upstream 827018 13494245 ~ 13515308 (+) True XLOC_012662
TCONS_00026876 lncRNA upstream 827173 13494240 ~ 13515153 (+) False XLOC_012662
TCONS_00027068 lncRNA upstream 1182572 13133657 ~ 13159754 (+) True XLOC_012654
TCONS_00026875 lncRNA upstream 1400306 12941800 ~ 12942020 (+) True XLOC_012652
TCONS_00025327 lncRNA downstream 224488 14645724 ~ 14647889 (+) False XLOC_012672
TCONS_00025328 lncRNA downstream 226684 14647920 ~ 14649295 (+) False XLOC_012672
TCONS_00025329 lncRNA downstream 231560 14652796 ~ 14655181 (+) True XLOC_012672
TCONS_00025332 lncRNA downstream 272538 14693774 ~ 14697233 (+) True XLOC_012674
TCONS_00026877 lncRNA downstream 1011470 15432706 ~ 15436113 (+) False XLOC_012680
TCONS_00025312 mRNA upstream 10266 14329231 ~ 14332060 (+) True XLOC_012666
TCONS_00025311 mRNA upstream 10463 14307059 ~ 14331863 (+) False XLOC_012666
TCONS_00025310 mRNA upstream 12887 14277003 ~ 14329439 (+) False XLOC_012666
TCONS_00025308 mRNA upstream 208291 13837746 ~ 14134035 (+) True XLOC_012663
TCONS_00025307 mRNA upstream 209606 13792490 ~ 14132720 (+) False XLOC_012663
TCONS_00025315 mRNA downstream 56504 14477740 ~ 14530633 (+) False XLOC_012668
TCONS_00025316 mRNA downstream 107769 14529005 ~ 14530633 (+) True XLOC_012668
TCONS_00025317 mRNA downstream 142849 14564085 ~ 14579787 (+) False XLOC_012669
TCONS_00025318 mRNA downstream 142850 14564086 ~ 14569649 (+) False XLOC_012669
TCONS_00025319 mRNA downstream 142850 14564086 ~ 14569658 (+) True XLOC_012669
TCONS_00025309 other upstream 393402 13948810 ~ 13948924 (+) True XLOC_012664
TCONS_00025284 other upstream 2511306 11830905 ~ 11831020 (+) True XLOC_012642
TCONS_00025282 other upstream 2884996 11457213 ~ 11457330 (+) True XLOC_012639
TCONS_00025273 other upstream 3600163 10742049 ~ 10742163 (+) True XLOC_012635
TCONS_00025271 other upstream 3671588 10670661 ~ 10670738 (+) True XLOC_012633
TCONS_00025324 other downstream 221635 14642871 ~ 14649295 (+) False XLOC_012672
TCONS_00025333 other downstream 567843 14989079 ~ 14996705 (+) True XLOC_012675
TCONS_00025343 other downstream 1291193 15712429 ~ 15712545 (+) True XLOC_012689
TCONS_00025358 other downstream 1712448 16133684 ~ 16140348 (+) False XLOC_012697
TCONS_00025367 other downstream 2294715 16715951 ~ 16719190 (+) False XLOC_012703

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000013_07293239_07332640.mRNA True 1810 mRNA 0.45 13 CI01000013 7292985 ~ 7332660 (-)