RNA id: TCONS_00032193


Basic Information

Item Value
RNA id TCONS_00032193
length 484
lncRNA type retained_intron
GC content 0.49
exon number 4
gene id XLOC_016345
representative False

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 22970140 ~ 23004355 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GATGAATCCAACTCCGAGGATGAAGCCTCTTCCAAATCAGAGCAGTCGGCTCCATCCAGTCCATCAAGTTCCAGCTCAAGCTCCAGCTCTGATTCTGACTTTGAGCCGTCGCAGAAACAAGGCCAAGGGACACTGCGTTCAATGGTCGAGGATATGCACTCTGAGGGCTCTGATGACGACAGTAGCTCTGAGGTTGAGACGCCCATGAAGACGACTCCATTCAACCACGACTCACGTTTGAGCATGGACAGTGAGAGTGATGGTAACGAGGAGTCTCGTCCTCCCAGCCAGGAAGCCCCCTCACCTTCACTCAAACTCAGCTCAGCAAACCTTAAGGTAAGTTCATATTGCATTGCGATGAAACTTCAGACTAAGTTAAGTCTGAAATCGTTGTATCCTTTGTCAGATGTTAGGAAAAAAGAGCCCAGACTCTTGCAATCGCGAGAAGATAATCAAGAGGGGATACGACAAGGTAGGAACGGTA

Function

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0005634 nucleus cellular_component
GO:0046872 metal ion binding molecular_function
GO:0003676 nucleic acid binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-060421-7142 Predicted to enable metal ion binding activity. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be located in nucleus. Is expressed in prechordal plate. Orthologous to human MLLT1 (MLLT1 super elongation complex subunit).

Ensembl:

ensembl_id ENSDART00000143925

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00033820 lncRNA downstream 105466 22857105 ~ 22868720 (-) True XLOC_016341
TCONS_00033819 lncRNA downstream 122481 22845662 ~ 22851705 (-) True XLOC_016340
TCONS_00033818 lncRNA downstream 211731 22758806 ~ 22762455 (-) True XLOC_016339
TCONS_00033817 lncRNA downstream 246755 22707739 ~ 22727431 (-) True XLOC_016338
TCONS_00032183 lncRNA downstream 287528 22682860 ~ 22686658 (-) True XLOC_016337
TCONS_00032195 lncRNA upstream 6678 22986256 ~ 22987491 (-) False XLOC_016345
TCONS_00033821 lncRNA upstream 45667 23025245 ~ 23026907 (-) False XLOC_016346
TCONS_00033822 lncRNA upstream 45667 23025245 ~ 23027062 (-) True XLOC_016346
TCONS_00032201 lncRNA upstream 105061 23084639 ~ 23087324 (-) True XLOC_016347
TCONS_00032206 lncRNA upstream 400718 23380296 ~ 23383634 (-) False XLOC_016350
TCONS_00032189 mRNA downstream 8059 22931159 ~ 22966127 (-) False XLOC_016344
TCONS_00032188 mRNA downstream 8059 22931159 ~ 22966127 (-) False XLOC_016344
TCONS_00032187 mRNA downstream 8059 22931159 ~ 22966127 (-) False XLOC_016344
TCONS_00032191 mRNA downstream 8089 22965131 ~ 22966097 (-) True XLOC_016344
TCONS_00032190 mRNA downstream 8110 22932355 ~ 22966076 (-) False XLOC_016344
TCONS_00032194 mRNA upstream 354 22979932 ~ 22993601 (-) False XLOC_016345
TCONS_00032197 mRNA upstream 10500 22990078 ~ 23004355 (-) False XLOC_016345
TCONS_00032196 mRNA upstream 10500 22990078 ~ 23004355 (-) False XLOC_016345
TCONS_00032198 mRNA upstream 14380 22993958 ~ 23004305 (-) False XLOC_016345
TCONS_00032200 mRNA upstream 22162 23001740 ~ 23004286 (-) True XLOC_016345
TCONS_00032186 other downstream 76785 22897285 ~ 22897401 (-) True XLOC_016343
TCONS_00032172 other downstream 539640 22434430 ~ 22434546 (-) True XLOC_016331
TCONS_00032140 other downstream 2216487 20757582 ~ 20757699 (-) True XLOC_016303
TCONS_00032138 other downstream 2269663 20702226 ~ 20704523 (-) False XLOC_016302
TCONS_00032139 other downstream 2269663 20702706 ~ 20704523 (-) True XLOC_016302
TCONS_00032199 other upstream 14443 22994021 ~ 23001370 (-) False XLOC_016345
TCONS_00032238 other upstream 1281639 24261217 ~ 24261296 (-) True XLOC_016372
TCONS_00032244 other upstream 1299261 24278839 ~ 24280795 (-) False XLOC_016373
TCONS_00032251 other upstream 1332189 24311767 ~ 24317208 (-) False XLOC_016374
TCONS_00032254 other upstream 1334167 24313745 ~ 24317205 (-) False XLOC_016374

Expression Profile

//