RNA id: TCONS_00066051


Basic Information

Item Value
RNA id TCONS_00066051
length 813
RNA type mRNA
GC content 0.49
exon number 4
gene id XLOC_033761
representative False

Chromosome Information

Item Value
chromosome id NC_007118.7
NCBI id CM002891.2
chromosome length 74282399
location 27455321 ~ 27697234 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGGGAGCAGACAAGGACGATCTGTCAGGACTCAAATGAGTTCAGAATAGTGATGGAGCTGAAGTGTTAGTGTGAAACACACACAACTCTATCAACATTGTACTTGGATCAGACAATATTTTCAGTCTAGACCTGGGAGGAATCCCGACTGTGATTCTAAATGGTTATGATGCCATTAAAGAGTGCCTGTATCACCAAAGTGAGGTTTTTGCAGACCGCCCGTCCCTCCCTTTATTCCAGAAGATGACAAAAATGGGAGGACTTCTGAACTGCAAATACGGCCGAGGCTGGATTGAGCACCACAAACTGGCTGTGAACTGCTTCCGCTACTTTGGCACTGGCCAGCGGATGTTTGAGAGGATTTCTGAAGAGTGCCTATATTTTCTTGATGCCATTGACCAGCACCAAGGCAAGCCCTTTAACCCCAAGCATCTGGTGACCAATGCGGTGTCCAATATCACCAACCTCATCATCTTTGGCCAGCGCTTCACCTATGACGATGGGGATTTTCAGCACATGATTGAGATCTTCAGTGAGAATGTGGAGCTGGCAGCCAGCAGTTGGGCTTTCCTGTACAACGCCTTCCCCTGGATGGAGTACCTGCCCTTTGGGAAGCACCAGAGGCTGTTCCGCAATGCCAACGAGGTCTATAAGTTCCTCCTGCAAATCATCAGGCGCTTCTCGCAGGGCAGGGTTCCCCAGTCGCCGCAACATTACATTGATGCCTACTTGGACGAAATGGAGCAAAGCACCCCTGATAAAGCCACTTCTTTCTCTCAAGACAATCTGATTTTCTCAGTTGGAGAACTGATCA

Function

GO:

id name namespace
GO:0071305 cellular response to vitamin D biological_process
GO:0042738 exogenous drug catabolic process biological_process
GO:0006082 organic acid metabolic process biological_process
GO:0071425 hematopoietic stem cell proliferation biological_process
GO:0070640 vitamin D3 metabolic process biological_process
GO:0055114 oxidation-reduction process biological_process
GO:0006805 xenobiotic metabolic process biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0005737 cytoplasm cellular_component
GO:0008395 steroid hydroxylase activity molecular_function
GO:0016705 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen molecular_function
GO:0016712 oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen molecular_function
GO:0004497 monooxygenase activity molecular_function
GO:0005506 iron ion binding molecular_function
GO:0046872 metal ion binding molecular_function
GO:0016491 oxidoreductase activity molecular_function
GO:0020037 heme binding molecular_function

KEGG:

id description
ko00100 Steroid biosynthesis
ko00199 Cytochrome P450

ZFIN:

id description
ZDB-GENE-110114-1 Predicted to enable heme binding activity; oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen; and steroid hydroxylase activity. Acts upstream of or within cellular response to vitamin D; hematopoietic stem cell proliferation; and vitamin D3 metabolic process. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in cytoplasm and intracellular membrane-bounded organelle. Is expressed in liver; muscle; ovary; and visceral fat. Used to study vitamin D-dependent rickets type 1B. Human ortholog(s) of this gene implicated in type 1 diabetes mellitus and vitamin D-dependent rickets type 1B. Orthologous to human CYP2R1 (cytochrome P450 family 2 subfamily R member 1).

Ensembl:

ensembl_id ENSDART00000148782

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00068856 lncRNA upstream 38223 27455327 ~ 27564988 (+) False XLOC_033761
TCONS_00066048 lncRNA upstream 153849 27444749 ~ 27449362 (+) True XLOC_033760
TCONS_00066047 lncRNA upstream 178624 27372433 ~ 27424587 (+) False XLOC_033760
TCONS_00068855 lncRNA upstream 554754 27044529 ~ 27048457 (+) True XLOC_033758
TCONS_00066033 lncRNA upstream 559211 27041373 ~ 27044000 (+) True XLOC_033756
TCONS_00066053 lncRNA downstream 102148 27797821 ~ 27799035 (+) True XLOC_033762
TCONS_00068858 lncRNA downstream 126771 27822444 ~ 27832323 (+) False XLOC_033764
TCONS_00068859 lncRNA downstream 127858 27823531 ~ 27832323 (+) False XLOC_033764
TCONS_00068860 lncRNA downstream 129958 27825631 ~ 27832323 (+) False XLOC_033764
TCONS_00068861 lncRNA downstream 132339 27828012 ~ 27832323 (+) True XLOC_033764
TCONS_00066042 mRNA upstream 148566 27251475 ~ 27454645 (+) False XLOC_033760
TCONS_00066040 mRNA upstream 150537 27250186 ~ 27452674 (+) False XLOC_033760
TCONS_00066045 mRNA upstream 153820 27290548 ~ 27449391 (+) False XLOC_033760
TCONS_00066039 mRNA upstream 153829 27250012 ~ 27449382 (+) False XLOC_033760
TCONS_00066043 mRNA upstream 153829 27253063 ~ 27449382 (+) False XLOC_033760
TCONS_00066054 mRNA downstream 106807 27802480 ~ 27820976 (+) True XLOC_033763
TCONS_00066056 mRNA downstream 138457 27834130 ~ 27887883 (+) False XLOC_033766
TCONS_00066058 mRNA downstream 202418 27898091 ~ 28058520 (+) False XLOC_033767
TCONS_00066059 mRNA downstream 202535 27898208 ~ 28035074 (+) False XLOC_033767
TCONS_00066061 mRNA downstream 280775 27976448 ~ 28058520 (+) False XLOC_033767
TCONS_00066036 other upstream 466565 27059394 ~ 27136646 (+) False XLOC_033759
TCONS_00066032 other upstream 559208 27041364 ~ 27044003 (+) False XLOC_033756
TCONS_00066034 other upstream 559369 27043715 ~ 27043842 (+) True XLOC_033757
TCONS_00066028 other upstream 711069 26888410 ~ 26892142 (+) True XLOC_033754
TCONS_00065996 other upstream 1482475 26120631 ~ 26120736 (+) True XLOC_033735
TCONS_00066055 other downstream 130272 27825945 ~ 27826061 (+) True XLOC_033765
TCONS_00066057 other downstream 152337 27848010 ~ 27879593 (+) True XLOC_033766
TCONS_00066060 other downstream 217265 27912938 ~ 27913055 (+) True XLOC_033768
TCONS_00066065 other downstream 557971 28253644 ~ 28255177 (+) False XLOC_033769
TCONS_00066066 other downstream 559423 28255096 ~ 28258626 (+) True XLOC_033769

Expression Profile

//