RNA id: TCONS_00073129


Basic Information

Item Value
RNA id TCONS_00073129
length 512
lncRNA type retained_intron
GC content 0.52
exon number 3
gene id XLOC_037145
representative True

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 24192370 ~ 24201159 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTGGACACTGGTGGCGATGGCCCGGAGGAGGCTGGACAGTCGCAGTGGGTCCTCGGCTCTGCTGTCAGAGATTCACTCTCACATCCACACGGATCCTCTGGACACCCTGTTTGACATAGGCAAAGAACTGGGCAGGGGGAAGTTTGCAGTGGTTAAGCGTTGTGTGGAAAAGACCACGGGTAAAGTCTTTGCTGCAAAGTTCATCAAGAAGCGGCGACGAGGTCGTGACTGCAGAGCAGATGTCATTCACGAGATTGCTGTTTTAGAGGCAGCCAAGAACAACCCTCGGGTGGTGAACTTGAACGCTGTATATGAGACTGATTATGACCTAGTTCTGATGCTGGAATTCGCGGCGGGTGGTGAGATATTTAACCACTGTGTGTCAGATGAGCTGCTGCCTGAAGGTCAGATCACTCGTCTCATCAGACAGATGCTTGAGGGCATTCACCTACTGCACCAGAGCAGCGTGGTCCACCTGGACCTAAAGGTCAGATACATGGCTGCTTTTAACA

Function

GO:

id name namespace
GO:0035556 intracellular signal transduction biological_process
GO:0043065 positive regulation of apoptotic process biological_process
GO:0006468 protein phosphorylation biological_process
GO:0016310 phosphorylation biological_process
GO:0005634 nucleus cellular_component
GO:0016740 transferase activity molecular_function
GO:0005524 ATP binding molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0004672 protein kinase activity molecular_function
GO:0004674 protein serine/threonine kinase activity molecular_function
GO:0016301 kinase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-1499 Predicted to enable protein serine/threonine kinase activity. Predicted to be involved in intracellular signal transduction and positive regulation of apoptotic process. Predicted to act upstream of or within protein phosphorylation. Predicted to be active in nucleus. Orthologous to human STK17B (serine/threonine kinase 17b).

Ensembl:

ensembl_id ENSDART00000146087

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00073122 lncRNA upstream 69924 24121106 ~ 24123115 (+) True XLOC_037142
TCONS_00073116 lncRNA upstream 104351 24066237 ~ 24088688 (+) False XLOC_037141
TCONS_00073107 lncRNA upstream 169670 24020513 ~ 24023369 (+) True XLOC_037139
TCONS_00073102 lncRNA upstream 288623 23895793 ~ 23904416 (+) True XLOC_037137
TCONS_00075110 lncRNA upstream 305758 23884749 ~ 23887281 (+) False XLOC_037136
TCONS_00073131 lncRNA downstream 11782 24209641 ~ 24212884 (+) False XLOC_037146
TCONS_00073133 lncRNA downstream 11806 24209665 ~ 24212884 (+) False XLOC_037146
TCONS_00075112 lncRNA downstream 881304 25079163 ~ 25080132 (+) False XLOC_037153
TCONS_00075113 lncRNA downstream 1367881 25565740 ~ 25599002 (+) False XLOC_037156
TCONS_00073147 lncRNA downstream 1369716 25567575 ~ 25642154 (+) False XLOC_037156
TCONS_00073126 mRNA upstream 894 24159280 ~ 24192145 (+) False XLOC_037144
TCONS_00073125 mRNA upstream 894 24159280 ~ 24192145 (+) False XLOC_037144
TCONS_00073127 mRNA upstream 5807 24159725 ~ 24187232 (+) True XLOC_037144
TCONS_00073124 mRNA upstream 47325 24126223 ~ 24145714 (+) True XLOC_037143
TCONS_00073123 mRNA upstream 47389 24125445 ~ 24145650 (+) False XLOC_037143
TCONS_00073130 mRNA downstream 10674 24208533 ~ 24212276 (+) False XLOC_037146
TCONS_00073132 mRNA downstream 11806 24209665 ~ 24212884 (+) True XLOC_037146
TCONS_00073136 mRNA downstream 510794 24708653 ~ 24710074 (+) True XLOC_037149
TCONS_00073137 mRNA downstream 722818 24920677 ~ 24951124 (+) False XLOC_037150
TCONS_00073138 mRNA downstream 738637 24936496 ~ 24951662 (+) True XLOC_037150
TCONS_00073118 other upstream 90748 24090907 ~ 24102291 (+) False XLOC_037141
TCONS_00073100 other upstream 306302 23885643 ~ 23886737 (+) True XLOC_037136
TCONS_00073090 other upstream 492583 23696924 ~ 23700456 (+) True XLOC_037131
TCONS_00073088 other upstream 637062 23547645 ~ 23555977 (+) True XLOC_037129
TCONS_00073080 other upstream 825830 23364242 ~ 23367209 (+) False XLOC_037128
TCONS_00073134 other downstream 186275 24384134 ~ 24387531 (+) True XLOC_037147
TCONS_00073135 other downstream 225933 24423792 ~ 24427240 (+) True XLOC_037148
TCONS_00073139 other downstream 868802 25066661 ~ 25067730 (+) True XLOC_037151
TCONS_00073140 other downstream 875680 25073539 ~ 25074199 (+) True XLOC_037152
TCONS_00073141 other downstream 881350 25079209 ~ 25080305 (+) True XLOC_037153

Expression Profile

//