RNA id: TCONS_00075305


Basic Information

Item Value
RNA id TCONS_00075305
length 208
lncRNA type sense_over
GC content 0.45
exon number 2
gene id XLOC_037678
representative True

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 12259469 ~ 12401871 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CACAAATGCGACCATTTGAGCTGTGTTTGAAGGTAAAGGTAAAACACCTGCCACTCTGGACTCTTCTAAATGCACATTCCATTCTCACTGAAGCCGTGCAGTTTTCTTGAGAGCAGTGATACTGAAAGCTGACATGTGCTCATCCATCAGTAAAGAGTGTTGATGGCTGTGCAGAGCAGGTGGGTCATTTGAGCCACTAAAAGCTTCT

Function

GO:

id name namespace
GO:0006607 NLS-bearing protein import into nucleus biological_process
GO:0006913 nucleocytoplasmic transport biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006999 nuclear pore organization biological_process
GO:0015031 protein transport biological_process
GO:0051028 mRNA transport biological_process
GO:0005634 nucleus cellular_component
GO:0005643 nuclear pore cellular_component
GO:0031965 nuclear membrane cellular_component
GO:0044613 nuclear pore central transport channel cellular_component
GO:0044615 nuclear pore nuclear basket cellular_component
GO:0017056 structural constituent of nuclear pore molecular_function
GO:0005543 phospholipid binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003697 single-stranded DNA binding molecular_function

KEGG:

id description
ko03013 Nucleocytoplasmic transport
ko05014 Amyotrophic lateral sclerosis
ko03019 Messenger RNA biogenesis

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00075304 lncRNA downstream 180367 12163937 ~ 12171785 (-) True XLOC_037677
TCONS_00075303 lncRNA downstream 180370 12076843 ~ 12171782 (-) False XLOC_037677
TCONS_00075302 lncRNA downstream 180377 12076843 ~ 12171775 (-) False XLOC_037677
TCONS_00074963 lncRNA downstream 180383 12143069 ~ 12171769 (-) False XLOC_037677
TCONS_00073979 lncRNA downstream 496847 11822379 ~ 11855305 (-) False XLOC_037675
TCONS_00074001 lncRNA upstream 188158 12589956 ~ 12594777 (-) True XLOC_037682
TCONS_00074006 lncRNA upstream 253507 12655305 ~ 12656425 (-) True XLOC_037685
TCONS_00074010 lncRNA upstream 325388 12727186 ~ 12736053 (-) False XLOC_037686
TCONS_00075306 lncRNA upstream 488100 12889898 ~ 12902782 (-) False XLOC_037688
TCONS_00075307 lncRNA upstream 497370 12899168 ~ 12903013 (-) True XLOC_037688
TCONS_00073983 mRNA downstream 82172 12262702 ~ 12269980 (-) False XLOC_037678
TCONS_00073981 mRNA downstream 82186 12259469 ~ 12269966 (-) False XLOC_037678
TCONS_00073985 mRNA downstream 82247 12265705 ~ 12269905 (-) False XLOC_037678
TCONS_00073984 mRNA downstream 82305 12265549 ~ 12269847 (-) False XLOC_037678
TCONS_00073980 mRNA downstream 317708 11906770 ~ 12034444 (-) True XLOC_037676
TCONS_00073986 mRNA upstream 1491 12403289 ~ 12424231 (-) False XLOC_037679
TCONS_00073987 mRNA upstream 3323 12405121 ~ 12424794 (-) False XLOC_037679
TCONS_00073988 mRNA upstream 3848 12405646 ~ 12424791 (-) True XLOC_037679
TCONS_00073989 mRNA upstream 26428 12428226 ~ 12443726 (-) True XLOC_037680
TCONS_00073990 mRNA upstream 66702 12468500 ~ 12493628 (-) False XLOC_037681
TCONS_00073978 other downstream 496847 11822379 ~ 11855305 (-) True XLOC_037675
TCONS_00073973 other downstream 780097 11571973 ~ 11572055 (-) True XLOC_037671
TCONS_00073967 other downstream 800448 11551604 ~ 11551704 (-) True XLOC_037669
TCONS_00073965 other downstream 801755 11548772 ~ 11550397 (-) False XLOC_037669
TCONS_00073961 other downstream 1505603 10845918 ~ 10846549 (-) True XLOC_037667
TCONS_00073998 other upstream 180468 12582266 ~ 12594717 (-) False XLOC_037682
TCONS_00073999 other upstream 182845 12584643 ~ 12594723 (-) False XLOC_037682
TCONS_00074000 other upstream 183105 12584903 ~ 12594705 (-) False XLOC_037682
TCONS_00074018 other upstream 483954 12885752 ~ 12887858 (-) True XLOC_037687
TCONS_00074026 other upstream 1437944 13839742 ~ 13853399 (-) True XLOC_037696