RNA id: TCONS_00007247


Basic Information

Item Value
RNA id TCONS_00007247
length 615
RNA type nonsense_mediated_decay
GC content 0.55
exon number 4
gene id XLOC_003764
representative False

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 45388126 ~ 45400146 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCCGAGCGCCATTACAGATCCGCAGTGATGCGCGCGTGAGGAGCAGGCCGCGACACACTTCATCCACTCCACGGAGGACAGATCGAGGCAAAATCGCGGATTTGGATGCATATTTACCGTCGCTGATCCAGGAAAATGGCGTCCAGCAGCACCAGCGTGATCCAGGTGACGAACGTGTCTCCGAGCAGCACCGCCGAGCAGATGAGGACTCTGTTCGGCTTCATCGGCAGCATCGACGAGCTCAGACTCTTCCCTCCAGATGATTCTCCCTTGCCTGTGACTTCACGTGTATGTTTTGTAAAGTTCCACGAGCCGGAGTCAGTCGGAGTATCGCAGCATCTGACGAACACAGTCTTCGTGGACCGAGCGCTGATCGTCGTCCCCTTCGCTGAAGCGAAGCAGCCGACCTGAATCGCTTGTTCATTATACAACTTATGAAACTTGAGAGCACATCCCAGTGGAGATCCGGCTGTGCTTGCTTACATTTGGTTCATGACTTAAAAAATCAAGTTCAGGAGTGATTCCTGATGAGTCCAAGGCTATGTCTCTGCTGGCTCCGGCCAATGCCGTTGCAGGATTGCTTCCAGGAGGCGGACTCCTCCCCACACCCAACCC

Function

GO:

id name namespace
GO:0008380 RNA splicing biological_process
GO:0005654 nucleoplasm cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0003676 nucleic acid binding molecular_function
GO:0003723 RNA binding molecular_function

KEGG:

id description
ko03041 Spliceosome

ZFIN:

id description
ZDB-GENE-030131-605 Predicted to enable RNA binding activity. Predicted to act upstream of or within RNA splicing. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in nucleoplasm. Orthologous to human SRSF11 (serine and arginine rich splicing factor 11).

Ensembl:

ensembl_id ENSDART00000168691

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00008718 lncRNA upstream 31859 45354855 ~ 45356339 (+) True XLOC_003763
TCONS_00007244 lncRNA upstream 36383 45350565 ~ 45351815 (+) True XLOC_003762
TCONS_00008436 lncRNA upstream 52325 45331401 ~ 45335873 (+) True XLOC_003761
TCONS_00007232 lncRNA upstream 151464 45234480 ~ 45236734 (+) True XLOC_003757
TCONS_00008717 lncRNA upstream 168811 45212765 ~ 45219387 (+) True XLOC_003754
TCONS_00008719 lncRNA downstream 19293 45412823 ~ 45413797 (+) True XLOC_003766
TCONS_00007258 lncRNA downstream 61026 45454556 ~ 45456610 (+) False XLOC_003768
TCONS_00007240 mRNA upstream 36374 45339906 ~ 45351824 (+) False XLOC_003762
TCONS_00007243 mRNA upstream 36375 45347961 ~ 45351823 (+) False XLOC_003762
TCONS_00007242 mRNA upstream 39502 45343245 ~ 45348696 (+) False XLOC_003762
TCONS_00007241 mRNA upstream 45543 45340115 ~ 45342655 (+) False XLOC_003762
TCONS_00007237 mRNA upstream 59689 45299447 ~ 45328509 (+) False XLOC_003760
TCONS_00007253 mRNA downstream 28231 45421761 ~ 45425893 (+) False XLOC_003767
TCONS_00007254 mRNA downstream 28676 45422206 ~ 45425752 (+) True XLOC_003767
TCONS_00007255 mRNA downstream 43173 45436703 ~ 45463766 (+) False XLOC_003768
TCONS_00007256 mRNA downstream 43179 45436709 ~ 45465268 (+) False XLOC_003768
TCONS_00007257 mRNA downstream 54682 45448212 ~ 45453725 (+) False XLOC_003768
TCONS_00007223 other upstream 536605 44851474 ~ 44851593 (+) True XLOC_003747
TCONS_00007206 other upstream 1052418 44335666 ~ 44335780 (+) True XLOC_003733
TCONS_00007205 other upstream 1052876 44328774 ~ 44335322 (+) True XLOC_003732
TCONS_00007204 other upstream 1053287 44324761 ~ 44334911 (+) False XLOC_003732
TCONS_00007203 other upstream 1061906 44324761 ~ 44326292 (+) False XLOC_003732

Expression Profile

//