RNA id: TCONS_00007738


Basic Information

Item Value
RNA id TCONS_00007738
length 645
RNA type mRNA
GC content 0.49
exon number 6
gene id XLOC_004056
representative True

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 15833565 ~ 15875054 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGTGACAGCTCCGTTACGTGAGGGGCTCGACAGGTATCACTGAGGGCAGCACGTGGGAGTTTTTCAATTCCCAAAGCTAGTTTCTTGTCCGAGGCTCTTTCGTGGAATGACCCAGTCCGCTGGAGGGGTTGAGGATAACTCCAGCTGAATAAGCTAAAGTTCGTCGGGTTTATTCTGGCCGGTGTGTGAAGAGCACTGCGGAGGCTGGTAAAGAGACCCTGCCATGCGTGAATACAAGCTTGTGGTGTTGGGCTCTGGTGGTGTGGGCAAGTCAGCCTTGACCGTCCAATTTGTTCAGGGGATATTCGTGGAGAAGTATGACCCTACAATTGAAGACTCCTACAGAAAGCAAGTTGAAGTTGATGGCCAGCAGTGCATGTTGGAAATCCTGGACACAGCAGGAACAGAGCAGTTCACAGCCATGAGGGATCTGTACATGAAGAACGGTCAGGGCTTTGCTCTCGTCTACTCAATTACAGCTCAGTCTACATTCAATGACTTGCAGGACTTACGAGAGCAGATACTACGTGTAAAGGATACAGAAGATAATGCTGTAATGAAGATATGTCAGCTTGTTTGGATCATGCCAGCATTCCCATCCTCAGAGAGTGACTCAGTGGAACAGCTGACTCAAAGGAGCACTGG

Function

GO:

id name namespace
GO:0071320 cellular response to cAMP biological_process
GO:2000301 negative regulation of synaptic vesicle exocytosis biological_process
GO:0032486 Rap protein signal transduction biological_process
GO:0060027 convergent extension involved in gastrulation biological_process
GO:0048701 embryonic cranial skeleton morphogenesis biological_process
GO:0007165 signal transduction biological_process
GO:0005886 plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0003924 GTPase activity molecular_function
GO:0005525 GTP binding molecular_function
GO:0019003 GDP binding molecular_function
GO:0000166 nucleotide binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-2738 Predicted to enable GDP binding activity; GTP binding activity; and GTPase activity. Acts upstream of or within convergent extension involved in gastrulation and embryonic cranial skeleton morphogenesis. Predicted to be located in membrane. Predicted to be active in plasma membrane. Orthologous to human RAP1A (RAP1A, member of RAS oncogene family).

Ensembl:

ensembl_id ENSDART00000166551

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00007734 lncRNA downstream 25378 15806643 ~ 15809019 (-) True XLOC_004055
TCONS_00007733 lncRNA downstream 26889 15806392 ~ 15807508 (-) False XLOC_004055
TCONS_00007732 lncRNA downstream 30760 15802450 ~ 15803637 (-) True XLOC_004054
TCONS_00007731 lncRNA downstream 34474 15798258 ~ 15799923 (-) True XLOC_004053
TCONS_00007729 lncRNA downstream 36829 15796093 ~ 15797568 (-) True XLOC_004052
TCONS_00007750 lncRNA upstream 229034 16104008 ~ 16115790 (-) True XLOC_004061
TCONS_00008461 lncRNA upstream 245038 16120012 ~ 16120290 (-) True XLOC_004062
TCONS_00007756 lncRNA upstream 304978 16179952 ~ 16181688 (-) True XLOC_004065
TCONS_00007762 lncRNA upstream 498698 16373672 ~ 16395302 (-) True XLOC_004066
TCONS_00007764 lncRNA upstream 794244 16669218 ~ 16675164 (-) True XLOC_004068
TCONS_00007727 mRNA downstream 398902 15345654 ~ 15435495 (-) True XLOC_004049
TCONS_00007723 mRNA downstream 537214 15270295 ~ 15297183 (-) False XLOC_004047
TCONS_00007740 mRNA upstream 139553 16014527 ~ 16021424 (-) False XLOC_004058
TCONS_00007742 mRNA upstream 144135 16019109 ~ 16021522 (-) False XLOC_004058
TCONS_00007743 mRNA upstream 145556 16020530 ~ 16021498 (-) False XLOC_004058
TCONS_00007746 mRNA upstream 209607 16084581 ~ 16093018 (-) False XLOC_004060
TCONS_00007747 mRNA upstream 209607 16084581 ~ 16093022 (-) True XLOC_004060
TCONS_00007689 other downstream 2351610 13482671 ~ 13482787 (-) True XLOC_004029
TCONS_00007673 other downstream 3078122 12756143 ~ 12756275 (-) True XLOC_004024
TCONS_00007664 other downstream 3142706 12691395 ~ 12691691 (-) True XLOC_004019
TCONS_00007658 other downstream 3212630 12621518 ~ 12621767 (-) True XLOC_004015
TCONS_00007656 other downstream 3243101 12590999 ~ 12591296 (-) True XLOC_004013
TCONS_00007741 other upstream 142909 16017883 ~ 16019615 (-) False XLOC_004058
TCONS_00007744 other upstream 145955 16020929 ~ 16021471 (-) True XLOC_004058
TCONS_00007745 other upstream 183217 16058191 ~ 16058307 (-) True XLOC_004059
TCONS_00007751 other upstream 252408 16127382 ~ 16127678 (-) True XLOC_004063
TCONS_00007758 other upstream 457850 16332824 ~ 16336886 (-) False XLOC_004066

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000058_00282795_00302233.mRNA True 1863 mRNA 0.37 4 CI01000058 281394 ~ 302233 (-)