RNA id: TU166876



Basic Information


Item Value
RNA id TU166876
length 222
lncRNA type inter_gene
GC content 0.50
exon number 1
gene id G133077
representative True

Chromosome Information


Item Value
chromosome id CM030138.1
NCBI id CM030138.1
chromosome length 24262032
location 5854488 ~ 5854709 (+)
genome version AmiCal1_2021_bowfin_Genome
species bowfin
(Amia calva)

Sequence


ATAATTTAGTGTTCGGTGTTGTCAGTCAGCGGATCGGCGCTGTCGCTCTCACTGCGTATTGATCACCGATCCTTATTAAAATATGTCTAATTATTGCTGTTGTGACTATTAACGTTGCACTTCGGCTCTCCCCCTGCACTCCCCGCTAGGCCGGGCCCTCCGTCCGAGCCGCCATGTTGTTTACATTGTCAAACTATGCCCTTTCTGCCGTCACATGACTGC

Function


GO:

id name namespace
GO:0002011 morphogenesis of an epithelial sheet biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0090504 epiboly biological_process
GO:0001702 gastrulation with mouth forming second biological_process

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU166873 lncRNA upstream 1763 5851874 ~ 5852725 (+) True G133074
TU166865 lncRNA upstream 9429 5844264 ~ 5845059 (+) True G133066
TU166859 lncRNA upstream 20447 5833815 ~ 5834041 (+) True G133060
TU166786 lncRNA upstream 55132 5772063 ~ 5799356 (+) True G133014
TU166754 lncRNA upstream 171680 5682073 ~ 5682808 (+) True G132997
TU166889 lncRNA downstream 15236 5869945 ~ 5870156 (+) True G133090
TU166898 lncRNA downstream 32296 5887005 ~ 5888723 (+) False AMCG00011837
TU166899 lncRNA downstream 32296 5887005 ~ 5887892 (+) False AMCG00011837
TU166910 lncRNA downstream 46994 5901703 ~ 5902803 (+) True G133108
TU166908 lncRNA downstream 51329 5906038 ~ 5906986 (+) False AMCG00011853
AMCG00011836 mRNA upstream 4480 5846142 ~ 5850008 (+) True AMCG00011836
AMCG00011835 mRNA upstream 11675 5835610 ~ 5842813 (+) True AMCG00011835
AMCG00011839 mRNA upstream 29622 5818212 ~ 5824866 (+) True AMCG00011839
AMCG00011838 mRNA upstream 62211 5788969 ~ 5792277 (+) True AMCG00011838
AMCG00011830 mRNA upstream 93621 5759880 ~ 5760867 (+) False AMCG00011830
AMCG00011834 mRNA downstream 17260 5871969 ~ 5883438 (+) True AMCG00011834
AMCG00011837 mRNA downstream 32208 5886917 ~ 5888884 (+) True AMCG00011837
AMCG00011853 mRNA downstream 38815 5893524 ~ 5907174 (+) True AMCG00011853
AMCG00011855 mRNA downstream 55772 5910481 ~ 5911354 (+) True AMCG00011855
AMCG00011852 mRNA downstream 70198 5924907 ~ 5936489 (+) True AMCG00011852
TU166858 other upstream 24956 5828801 ~ 5829532 (+) True G133059
TU166792 other upstream 93240 5759858 ~ 5761248 (+) True AMCG00011830
TU166232 other upstream 1911126 3941933 ~ 3943362 (+) False AMCG00011771
TU166218 other upstream 1916096 3903675 ~ 3938392 (+) False AMCG00011771
TU166214 other upstream 1958309 3892381 ~ 3896179 (+) False AMCG00011770
TU166896 other downstream 32296 5887005 ~ 5887892 (+) False AMCG00011837
TU166897 other downstream 32296 5887005 ~ 5887892 (+) False AMCG00011837
TU167105 other downstream 401241 6255950 ~ 6256682 (+) False AMCG00011876
TU167207 other downstream 629238 6483947 ~ 6489208 (+) True G133327
TU167225 other downstream 690679 6545388 ~ 6558485 (+) False AMCG00011909

Expression Profile