G245231


Basic Information

Item Value
gene id G245231
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 3087096 ~ 3292562 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU278389
CCTGTATGGCGATGGTTAGGGAAGATGCCTGGAAGTGTTTCTCAATTCCATTGGCTACTCTCTGTGTGGTCATGAATAGATCTGCCACCTCTTCAGGACGAAGATCCCGAAACCGCTCAACAACACGAAGAGGACACACTAGAACATGGCCAGGCACGACCGGCTTTCGGTTGACTAGTGCGAAGGATAACTCCGTCTTCAAAAACACAGCAGAGGACTTTATGATGTGCTGCCCAAAGCGCAACGTAGCCATAGTGGATCATCAATTTCTTCACTCTGAACTTTCCCTGAGCACCCAGCTCATGTAATTAATGAGAGAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU278389 True 321 TUCP 0.48 3 3087096 3292562

Neighbor

gene id symbol gene type direction distance location
CI01000057_02884788_02888727 NA coding upstream 198291 2884081 ~ 2888805 (+)
CI01000057_02794112_02799150 NA coding upstream 287943 2793991 ~ 2799153 (+)
CI01000057_02758170_02782493 CAMK1A, CAMK1.L, CAMK1B, CAMK1 coding upstream 304530 2758170 ~ 2782566 (+)
CI01000057_02707814_02708251 NA coding upstream 378722 2707814 ~ 2708374 (+)
CI01000057_02693930_02700711 GNL3 coding upstream 386385 2693930 ~ 2700711 (+)
CI01000057_03326630_03330891 NA coding downstream 32157 3324719 ~ 3331089 (+)
CI01000057_03496993_03600733 PTPRG, PTPRGA coding downstream 204431 3496993 ~ 3600733 (+)
CI01000057_03611693_03627832 CSE1L coding downstream 319131 3611693 ~ 3628414 (+)
CI01000057_03636623_03639946 NA coding downstream 344061 3636623 ~ 3640129 (+)
CI01000057_03652858_03668897 NA coding downstream 360244 3652806 ~ 3669092 (+)
G245199 NA non-coding upstream 2725 3013131 ~ 3084371 (+)
G245200 NA non-coding upstream 46042 3018556 ~ 3041054 (+)
G245196 NA non-coding upstream 79172 3007677 ~ 3007924 (+)
G245195 NA non-coding upstream 82086 3004792 ~ 3005010 (+)
G245189 NA non-coding upstream 102288 2984589 ~ 2984808 (+)
G245389 NA non-coding downstream 34224 3326786 ~ 3327170 (+)
G245360 NA non-coding downstream 44699 3337261 ~ 3352596 (+)
G245428 NA non-coding downstream 390592 3683154 ~ 3683354 (+)
G245358 NA non-coding downstream 413795 3706357 ~ 3706854 (+)
G245349 NA non-coding downstream 415266 3707828 ~ 3708448 (+)
G243991 NA other upstream 434536 2635237 ~ 2652560 (+)
G243975 NA other upstream 510244 2576453 ~ 2576852 (+)
CI01000057_02395285_02396439 NA other upstream 690614 2394598 ~ 2396561 (+)
G243558 NA other upstream 2128725 956063 ~ 958371 (+)
G243557 NA other upstream 2131901 954843 ~ 955195 (+)
G245401 NA other downstream 245007 3537569 ~ 3538442 (+)
CI01000057_03842028_03844033 NDUFS7.S, MGC85267, NDUFS7 other downstream 549466 3842028 ~ 3844691 (+)
G245486 NA other downstream 917335 4209897 ~ 4212081 (+)
G245725 NA other downstream 1806123 5098685 ~ 5103606 (+)
CI01000057_05564489_05579041 NA other downstream 2281342 5564489 ~ 5579843 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_032404 fhit coding NC_007117.7 CM002890.2 54078703 ~ 54080052 (+)