G245349


Basic Information

Item Value
gene id G245349
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 3707828 ~ 3708448 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU278514
AGAAAATCATAACTTAATAGAAAAACTACTTTTTTGACCATTTTCCAATACCAAAAATCTTTGTTTTTAGATCCATTAGATCCATCCTGATTCTGAAGAGAAAATTGCAGAAGTGTCAAAGGTCAGGTTCAGCTGACAGCAGAGAGGAAGTATTTTCTCAGAAAGCTGCGCTCCGGAAGCAGATCAGAGGGGAAGTGTTCAGTATCCTGAGCAGTTTGGCAGATCTCAGCAATGCCATTCACTGGATGCCTCCTGGATTTCTGTGGGCTGGACGGTTTCCTCCATGGCTGGTGGGACTGATGGGAACGGTCTCCTCTCTGATAGGTCTTCTACAGATGAGCTCCAGTGATCAAGGAGCATGTACCTAAAGCATTACACACACATCAATTTAATAATTAATAATTATGTTTAACAATGTGCAATTTATACAGACTCACTGATGAGTCTGTATTTTGAAATTCTGTTAACTTCTACACTGGTGAATAGTTAAAAAAACAATGTTATATTCAATTGTAGATGGATGAATGTCTTTGTGAAAAT

Function

NR:

description
trophoblast glycoprotein-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU278514 True 540 lncRNA 0.39 2 3707828 3708448

Neighbor

gene id symbol gene type direction distance location
CI01000057_03692584_03701758 NA coding upstream 5796 3692584 ~ 3702032 (+)
CI01000057_03669937_03677055 SLC35E1 coding upstream 29947 3669410 ~ 3677881 (+)
CI01000057_03652858_03668897 NA coding upstream 38736 3652806 ~ 3669092 (+)
CI01000057_03636623_03639946 NA coding upstream 67699 3636623 ~ 3640129 (+)
CI01000057_03611693_03627832 CSE1L coding upstream 79414 3611693 ~ 3628414 (+)
CI01000057_03709399_03714556 NA coding downstream 496 3708944 ~ 3714559 (+)
CI01000057_03719251_03750681 NA coding downstream 10803 3719251 ~ 3750801 (+)
CI01000057_03752329_03758938 R3HDM4 coding downstream 42956 3751404 ~ 3759109 (+)
CI01000057_03790271_03807327 ARID3A coding downstream 81741 3790189 ~ 3807327 (+)
CI01000057_03817584_03827165 CTDSPL3 coding downstream 108578 3817026 ~ 3827165 (+)
G245358 NA non-coding upstream 974 3706357 ~ 3706854 (+)
G245428 NA non-coding upstream 24474 3683154 ~ 3683354 (+)
G245360 NA non-coding upstream 355232 3337261 ~ 3352596 (+)
G245389 NA non-coding upstream 380658 3326786 ~ 3327170 (+)
G245199 NA non-coding upstream 623457 3013131 ~ 3084371 (+)
G245430 NA non-coding downstream 55863 3764311 ~ 3764625 (+)
G245357 NA non-coding downstream 107185 3815633 ~ 3816359 (+)
G245341 NA non-coding downstream 138855 3847303 ~ 3848415 (+)
G245346 NA non-coding downstream 140723 3849171 ~ 3851942 (+)
G245439 NA non-coding downstream 189876 3898324 ~ 3898641 (+)
G245401 NA other upstream 169386 3537569 ~ 3538442 (+)
G245231 NA other upstream 415266 3087096 ~ 3292562 (+)
G243991 NA other upstream 1055268 2635237 ~ 2652560 (+)
G243975 NA other upstream 1130976 2576453 ~ 2576852 (+)
CI01000057_02395285_02396439 NA other upstream 1311346 2394598 ~ 2396561 (+)
CI01000057_03842028_03844033 NDUFS7.S, MGC85267, NDUFS7 other downstream 133580 3842028 ~ 3844691 (+)
G245486 NA other downstream 501449 4209897 ~ 4212081 (+)
G245725 NA other downstream 1390237 5098685 ~ 5103606 (+)
CI01000057_05564489_05579041 NA other downstream 1865456 5564489 ~ 5579843 (+)
G245856 NA other downstream 1929206 5637654 ~ 5643340 (+)

Expression


Co-expression Network