G454649



Basic Information


Item Value
gene id G454649
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000320
NCBI id null
chromosome length 3894707
location 982583 ~ 982844 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU521985
CGTTTGAATTGCTTTGGGTTGCTCTGTTTCCTCCGGGACATTCCTGCTCCGCGCGCTGGTCTCGAGATTAAAAAATGATACTGCGATTCATCCAAACACAGATAAACGTGCTGTCTGTAAGACTCGGATGTGTTTCAGTGTCTGTCTGATTCCAGTCAGGGTTAGTTGGTGTCGTCGTGTAGAGGGTTAAGTTGTGTTGTGATCCGAGCGCACACTGACAGCGCAGATGAGCGCGTGTTGTGCTTTTGTTGCAGGAGGTTTG

Function


NR:

description
hypothetical protein EH28_24508, partial

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU521985 True 262 lncRNA 0.49 1 982583 982844

Neighbor


gene id symbol gene type direction distance location
CI01000320_00935826_00945755 LRP12 coding downstream 36828 934432 ~ 945755 (-)
CI01000320_00745852_00758696 SLC25A32A, SLC25A32 coding downstream 223477 745030 ~ 759106 (-)
CI01000320_00688829_00696138 NA coding downstream 286395 688688 ~ 696188 (-)
CI01000320_00586900_00592523 FAM210AA coding downstream 390060 585993 ~ 592523 (-)
CI01000320_00442550_00456381 PTPN2B coding downstream 526196 442124 ~ 456387 (-)
CI01000320_01042859_01043564 NA coding upstream 59180 1042024 ~ 1043564 (-)
CI01000320_01176457_01181900 NA coding upstream 191891 1174735 ~ 1181900 (-)
CI01000320_01207179_01217428 EPB41 coding upstream 224335 1207179 ~ 1217438 (-)
CI01000320_01263151_01266426 CTGFB coding upstream 280195 1263039 ~ 1266426 (-)
CI01000320_01310476_01318751 STX12 coding upstream 327500 1310344 ~ 1318751 (-)
G454639 NA non-coding downstream 56274 926064 ~ 926309 (-)
G454615 NA non-coding downstream 115292 849157 ~ 867291 (-)
G454593 NA non-coding downstream 246677 733458 ~ 735906 (-)
G454545 NA non-coding downstream 253216 650216 ~ 729367 (-)
G454650 NA non-coding upstream 19645 1002489 ~ 1002717 (-)
G454651 NA non-coding upstream 21446 1004290 ~ 1004509 (-)
G454652 NA non-coding upstream 21979 1004823 ~ 1005133 (-)
G454653 NA non-coding upstream 22356 1005200 ~ 1005599 (-)
G454654 NA non-coding upstream 23121 1005965 ~ 1006192 (-)
G454495 NA other downstream 454031 527059 ~ 528552 (-)
CI01000320_00346954_00349228 ZNF706.2.S, ZNF706.2.L, ZNF706, ZNF706.2 other downstream 632381 346199 ~ 349445 (-)
G454663 NA other upstream 68624 1051468 ~ 1055895 (-)
G454686 NA other upstream 158398 1141242 ~ 1141880 (-)
CI01000320_01338270_01341123 SH3BGRL3 other upstream 353435 1336279 ~ 1343274 (-)
CI01000320_01426753_01430603 NA other upstream 443939 1426176 ~ 1430654 (-)
G456317 NA other upstream 2660393 3643237 ~ 3648040 (-)

Expression



Co-expression Network