G454545


Basic Information

Item Value
gene id G454545
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000320
NCBI id null
chromosome length 3894707
location 650216 ~ 729367 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU521864
TTAGAATATGAATATGTGGTGTTTGCCCGTGCAAACATGTCTGCCATGATGCTATAGTGTTGTGGTAACACTGAAGCAGAGTTAAAGTTAATGAGATAATTAAGTGATTAATTAAGTTATGATTGAGCATTAGTGATGAACACCTGCTGTTAACAAGCAGAATCACTGAAGAGAAATACAATAACTACAAATGACTTCCAGCCACAGCCTTAGATGAAATCAACTGAAGATAAAAGACATTAAAT
>TU521865
AGTGTTGGGGTAACACTGAAGCAGAGTTAAAGTTAATGAGATAATTAAGTGATTAATTAAGTTATGATTGAGCATTAGTGATGAACACCTGCTGTTAACAAGCAGAATCACTGAAGAGAAATACAATAACTACAAATGACTTCCAGCCACAGCCTTAGATGAAATCAACTGAAGATAAAAGACATTAAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU521864 False 245 lncRNA 0.34 2 650216 729367
TU521865 True 190 lncRNA 0.33 2 650216 667842

Neighbor

gene id symbol gene type direction distance location
CI01000320_00586900_00592523 FAM210AA coding downstream 57693 585993 ~ 592523 (-)
CI01000320_00442550_00456381 PTPN2B coding downstream 193829 442124 ~ 456387 (-)
CI01000320_00420198_00423170 NA coding downstream 227046 419963 ~ 423170 (-)
CI01000320_00388838_00393457 NCALDA, NCALDB, HPCAL1, NCALD, HPCAL1.L, HPCA.S, NCALD.L, HPCA coding downstream 256759 388507 ~ 393457 (-)
CI01000320_00346954_00349228 ZNF706.2.S, ZNF706.2.L, ZNF706, ZNF706.2 coding downstream 300771 346199 ~ 349445 (-)
CI01000320_00745852_00758696 SLC25A32A, SLC25A32 coding upstream 15663 745030 ~ 759106 (-)
CI01000320_00935826_00945755 LRP12 coding upstream 205065 934432 ~ 945755 (-)
CI01000320_01042859_01043564 NA coding upstream 312657 1042024 ~ 1043564 (-)
CI01000320_01176457_01181900 NA coding upstream 445368 1174735 ~ 1181900 (-)
CI01000320_01207179_01217428 EPB41 coding upstream 477812 1207179 ~ 1217438 (-)
G454538 NA non-coding downstream 24016 625919 ~ 626200 (-)
G454528 NA non-coding downstream 35644 614363 ~ 614572 (-)
G454525 NA non-coding downstream 37749 611519 ~ 612467 (-)
G454479 NA non-coding downstream 93297 556268 ~ 556919 (-)
G454495 NA non-coding downstream 122006 527059 ~ 528552 (-)
G454593 NA non-coding upstream 4091 733458 ~ 735906 (-)
G454615 NA non-coding upstream 119790 849157 ~ 867291 (-)
G454639 NA non-coding upstream 196697 926064 ~ 926309 (-)
G454649 NA non-coding upstream 253216 982583 ~ 982844 (-)
G454650 NA non-coding upstream 273122 1002489 ~ 1002717 (-)
G454663 NA other upstream 322101 1051468 ~ 1055895 (-)
G454686 NA other upstream 411875 1141242 ~ 1141880 (-)
CI01000320_01338270_01341123 SH3BGRL3 other upstream 606912 1336279 ~ 1343274 (-)
CI01000320_01426753_01430603 NA other upstream 697416 1426176 ~ 1430654 (-)
G456317 NA other upstream 2913870 3643237 ~ 3648040 (-)

Expression


Co-expression Network