XLOC_002238 (zbtb21)


Basic Information

Item Value
gene id XLOC_002238
gene name zbtb21
gene type coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 32646402 ~ 32648803 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00004286
AAATACAAGATGGATGGAATCACGACTGCTTCATGCTCAACGCAACTCTGAAACAAAGTCCAGTGTCGGAGCTCCGCGGCGCCCAAAGCCACCCAGGCAGGCCAAAATGGAAAGCCTGGGGCACTACTGTAACCCAGCCCATGGTATTTCACTGCTGGGTTCCCTCAACGAGCAGCGCTTGAAAGGCCAGCTCTGTGATGTTGTGTTGTTAGTGGGTGATCAACAGTACCAGGCCCATAAAAGCATCCTTGCAGCCTGCAGTGAGTATTTCCAGTCTGTGTTCTCCAGAAGGGACTCGGAGAACCGCTCCATTGTTCAGCTTGACTTCTGTGAGCCCGATGCTTTTGAGATTGTGCTAAACTACATCTACTCCTCGTCTCTGTTTGTGGAGAAATGTAGCCTGGCGGCCATACAGGAGCTGGGATACAGCCTCGGCATTCCTTTTCTAACCAACATCATGTCTGTAAGACCTCAGGCTTCATACTGCGTGT

Function

symbol description
zbtb21 Predicted to be involved in regulation of gene expression. Predicted to be active in nucleus. Orthologous to human ZBTB21 (zinc finger and BTB domain containing 21).

GO:

id name namespace
GO:0010468 regulation of gene expression biological_process
GO:0005634 nucleus cellular_component

KEGG:

id description
ko03000 Transcription factors

ZFIN:

id description
ZDB-GENE-050411-7 Predicted to be involved in regulation of gene expression. Predicted to be active in nucleus. Orthologous to human ZBTB21 (zinc finger and BTB domain containing 21).

Ensembl:

ensembl_id ENSDARG00000043285

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00004286 True 491 mRNA 0.51 2 32646402 32648803

Neighbor

gene id symbol gene type direction distance location
XLOC_002236 map6a coding upstream 45022 32560667 ~ 32601380 (+)
XLOC_002237 NA coding upstream 54331 32584417 ~ 32592071 (+)
XLOC_002235 CR388187.1 coding upstream 250506 32395780 ~ 32395896 (+)
XLOC_002234 NA coding upstream 382104 32259743 ~ 32264298 (+)
XLOC_002233 wnt11 coding upstream 523198 32104305 ~ 32123204 (+)
XLOC_002239 rad51c coding downstream 14083 32662886 ~ 32672508 (+)
XLOC_002240 ppm1e coding downstream 34286 32683089 ~ 32788832 (+)
XLOC_002241 CU929186.1 coding downstream 353516 33002319 ~ 33002433 (+)
XLOC_002242 myl10 coding downstream 522698 33171501 ~ 33179988 (+)
XLOC_002243 NA coding downstream 616578 33265381 ~ 33265687 (+)
XLOC_002228 NA non-coding upstream 604556 31869282 ~ 32041846 (+)
XLOC_002229 NA non-coding upstream 697858 31946837 ~ 31948544 (+)
XLOC_002244 NA non-coding downstream 708293 33357096 ~ 33359026 (+)
XLOC_002245 NA non-coding downstream 711525 33360328 ~ 33368165 (+)
XLOC_002252 NA non-coding downstream 1221386 33870189 ~ 33871012 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000304_15776859_15777750 ZBTB21 coding CI01000304 null 15776859 ~ 15777768 (+)