CI01000001_13297434_13300865 (TRAPPC6B, GM13880)


Basic Information

Item Value
gene id CI01000001_13297434_13300865
gene name TRAPPC6B, GM13880
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000001
NCBI id null
chromosome length 13537560
location 13297434 ~ 13300865 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000001_13297434_13300865.mRNA
TTTCAGTCTGGCTTTGGCTGAACTGGCTTGAGATGGCAGACGAGGCTCTCTTTCAGTTCCTTCACAGTGAAATTATTCAGTATGTCAACAGTGCAGAAACTGGAGAATCGGAGAATGGACGATGTGTTTCTAAACTTGAGAACATGGGGTTTCGTGTGGGACAAGGACTTATTGAGAGGTTTACCAAAGACACACCACGTTTCAAAGATGAGCTTGATGTCATGAAGTTCATCTGCAAAGATTTTTGGACCAGTGTTTTTAAGAAGCAGATTGACAACCTGAGAACAAACCACCAGGGTATTTATGTGTTACAAGATAACAAGTTCCGTCTGCTGACACAACTGTCTGCTGGCAAACAGTATCTGGAACATGCGCCGAAGTTTTTAGCTTTCACCTGTGGACTCGTCCGAGGAGCACTTTCAAACCTTGGTGTGAAAAGTATAGTCACAGCGGAAGTGTCGGTCATGCCTGCCTCCTTTCAGGTTGCGATAGGAGGCACTCATTTGAACT

Function

symbol description
trappc6b Predicted to be involved in endoplasmic reticulum to Golgi vesicle-mediated transport. Predicted to act upstream of or within Golgi vesicle transport; nervous system development; and regulation of GTPase activity. Predicted to be located in Golgi apparatus and endoplasmic reticulum. Predicted to be part of TRAPP complex. Predicted to be active in cis-Golgi network and trans-Golgi network. Is expressed in central nervous system. Used to study syndromic intellectual disability. Orthologous to human TRAPPC6B (trafficking protein particle complex subunit 6B).

GO:

id name namespace
GO:0048208 COPII vesicle coating biological_process

KEGG:

id description
K20304 TRAPPC6, TRS33; trafficking protein particle complex subunit 6

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000001_13297434_13300865.mRNA True 510 mRNA 0.45 6 13297434 13300865

Neighbor

gene id symbol gene type direction distance location
CI01000001_13290327_13291466 PLAGX coding upstream 3955 13289607 ~ 13293479 (+)
CI01000001_13266612_13285039 PAN2 coding upstream 12141 13266543 ~ 13285293 (+)
CI01000001_13242387_13245977 NEMP1 coding upstream 51189 13242387 ~ 13246245 (+)
CI01000001_13235608_13240350 NA coding upstream 56993 13235608 ~ 13240441 (+)
CI01000001_13220895_13223877 ARMC1L coding upstream 73064 13220895 ~ 13224370 (+)
CI01000001_13301404_13306593 TPX2 coding downstream 539 13301404 ~ 13306593 (+)
CI01000001_13309045_13319725 NA coding downstream 8180 13309045 ~ 13319879 (+)
CI01000001_13329841_13334948 NA coding downstream 28976 13329841 ~ 13335302 (+)
CI01000001_13342394_13343095 NA coding downstream 41228 13342093 ~ 13343784 (+)
CI01000001_13470823_13478394 NA coding downstream 169805 13470670 ~ 13478398 (+)
G19990 NA non-coding upstream 1100 13295976 ~ 13296334 (+)
G19864 NA non-coding upstream 55307 13241470 ~ 13242127 (+)
G19880 NA non-coding upstream 56193 13240840 ~ 13241241 (+)
G19979 NA non-coding upstream 88461 13208625 ~ 13208973 (+)
G19972 NA non-coding upstream 93662 13203550 ~ 13203772 (+)
G19878 NA non-coding downstream 76775 13377640 ~ 13379606 (+)
G19993 NA non-coding downstream 80766 13381631 ~ 13381868 (+)
G19996 NA non-coding downstream 82253 13383118 ~ 13383516 (+)
G20007 NA non-coding downstream 97927 13398792 ~ 13399137 (+)
G19883 NA non-coding downstream 165678 13466543 ~ 13470559 (+)
G19395 NA other upstream 1615617 11681322 ~ 11681817 (+)
G19314 NA other upstream 1738761 11501194 ~ 11558673 (+)
G19039 NA other upstream 2443451 10850924 ~ 10853983 (+)
CI01000001_10538498_10539667 RPS26 other upstream 2757588 10538388 ~ 10539846 (+)
G18937 NA other upstream 2821045 10474984 ~ 10476389 (+)
CI01000001_13514115_13517063 NA other downstream 212539 13514115 ~ 13517063 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_021801 trappc6b coding NC_007134.7 CM002907.2 32021803 ~ 32027198 (+)