G37363


Basic Information

Item Value
gene id G37363
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000005
NCBI id null
chromosome length 7630583
location 3919643 ~ 3920159 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU42404
ACACAGCCCATTATTAAAGACGTCAAGAGTGATCCGCTCGATATGCGGGGTAAATGACGTGAAGCTGTGCATTTTCTGCTGTGCTGGTTCCATTACACTTCTGCTGAGTTCATGTTTTGGGCTGTAACTCCACTCTTTTAGCATCTTAAGAAGGCAGAGGAGATCTTCAGGTTCTCTCAGCTGAATACTGTAGAAGAATGAAGAGATTTGGTCGAGTTGGATATGATGGGCCGGATAGCCTTGAGCTTGAACTGACTGATGGAGTCTCTAGTCAGTCAATCGTAGCTCCTCGAGTATCCGTGACATCAGTTAAAGATATGGGACAGTCAGTCGCTCACCTGGCGTCCTATGCAAGAGGCCGCTGGAAAAATGCTGCCCGCAAGTCTGTGAGGAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU42404 True 395 lncRNA 0.48 2 3919643 3920159

Neighbor

gene id symbol gene type direction distance location
CI01000005_03886705_03918267 NA coding upstream 1207 3884365 ~ 3918454 (+)
CI01000005_03804929_03868048 NA coding upstream 51362 3804885 ~ 3868281 (+)
CI01000005_03782413_03784445 NA coding upstream 134824 3782413 ~ 3784819 (+)
CI01000005_03600059_03605667 NA coding upstream 313668 3599574 ~ 3605975 (+)
CI01000005_03521422_03522147 NA coding upstream 397267 3519224 ~ 3522376 (+)
CI01000005_03924325_03937249 NA coding downstream 4166 3924325 ~ 3937423 (+)
CI01000005_03944039_03979362 UBR2 coding downstream 23880 3944039 ~ 3979659 (+)
CI01000005_04009363_04009659 NA coding downstream 87967 4008126 ~ 4009791 (+)
CI01000005_04073488_04107874 PKDCCA coding downstream 153329 4073488 ~ 4107874 (+)
CI01000005_04265065_04289873 EML4 coding downstream 344906 4265065 ~ 4290210 (+)
G37344 NA non-coding upstream 314673 3604755 ~ 3604970 (+)
G37343 NA non-coding upstream 316665 3602747 ~ 3602978 (+)
G37325 NA non-coding upstream 348371 3570177 ~ 3571272 (+)
G37297 NA non-coding upstream 401194 3516442 ~ 3518449 (+)
G37366 NA non-coding downstream 20578 3940737 ~ 3941309 (+)
G37439 NA non-coding downstream 96606 4016765 ~ 4017597 (+)
G37378 NA non-coding downstream 124961 4045120 ~ 4045640 (+)
G38219 NA non-coding downstream 127376 4047535 ~ 4047735 (+)
G38254 NA non-coding downstream 144337 4064496 ~ 4064764 (+)
G37392 NA other upstream 196140 3722744 ~ 3723503 (+)
G36291 NA other upstream 2258611 1659733 ~ 1661032 (+)
G36223 NA other upstream 2381839 1503143 ~ 1537804 (+)
G35533 NA other upstream 3395862 491908 ~ 523781 (+)
CI01000005_04735429_04736817 COX20 other downstream 815187 4735346 ~ 4737082 (+)
G39930 NA other downstream 3077385 6997544 ~ 6998340 (+)
CI01000005_07600541_07600974 NA other downstream 3677830 7600541 ~ 7602964 (+)

Expression


Co-expression Network